Labshake search
Citations for Addgene :
251 - 300 of 471 citations for Zika Virus Lysate DakArD 41662 strain since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... we infected the neurons with the retrograde virus pGP-AAVrg-syn-jGCaMP7s-WPRE (Addgene, Plasmid #104487-AAVrg). Injections (450 μL ...
-
bioRxiv - Neuroscience 2022Quote: ... A small volume (0.4 μl total) of virus (AAV8-EF1α-CreOn/FlpOn-GCaMP6f (RRID:Addgene_137122, titer 6.10E+13) for Aldh1a1-iCre/Th-Flpo and VGlut2-IRES-Cre/Th-Flpo mice ...
-
bioRxiv - Neuroscience 2022Quote: ... Cre-positive mice received the AAV-ChR2 injection (test mice) or a control virus AAV-YFP (Addgene) (control mice) ...
-
bioRxiv - Neuroscience 2022Quote: Tobfl/fl mice were bilaterally injected with Cre-expressing adeno-associated virus AAV1.hSyn.Cre.WPRE.hGH (105553-AAV1, Addgene) to generate hippocampus-specific KO mice ...
-
bioRxiv - Genomics 2022Quote: ... Wild-type (J1) mESCs were transduced with Cas9-blast virus (generated from pLentiCas9-Blast, Addgene ID: 52962) and selected with 10μg/ml blasticidin (InvivoGen ...
-
bioRxiv - Neuroscience 2022Quote: ... DAT-IRES-Cre mice (RRID: IMSR_JAX:027178) were injected with AAV1-CAG-FLEX-GCaMP6f virus (RRID: Addgene_100835). For labelling of SNc Anxa1+ neurons ...
-
bioRxiv - Immunology 2023Quote: ... 0.5 µg of a plasmid encoding the vesicular stomatitis virus G protein (pMD2.G, Addgene plasmid #12259), 0.25 µg of a plasmid encoding for the transactivating protein Rev (pRSV-Rev ...
-
bioRxiv - Cell Biology 2023Quote: ... Virus was generated in HEK293T cells by transfection with the aforementioned transfer vectors and pMDLg (Addgene 12251), pRSV-REV (Addgene 12253) ...
-
bioRxiv - Neuroscience 2023Quote: ... or a control virus (AAV2-hSyn-DIO-EGFP, 100 µL at titer ≥ 3×10¹² vg/mL, Addgene). A subset of the optogenetic L6-CT experiments was done in Ntsr1-Cre-ChR2-EYFP mice ...
-
bioRxiv - Neuroscience 2023Quote: ... 5HT and NPY interneurons in the ACC 200 nl of virus (pAAV-hSyn-DIO-mCherry, Addgene 50459) was injected into the ACC ...
-
bioRxiv - Neuroscience 2023Quote: ... Virus expressing gCaMP7f (AAV1-syn-jGCaMP7f-WPRE, stock concentration 3 x 1013 vg/mL, Addgene, 104488-AAV1)53 ...
-
bioRxiv - Neuroscience 2023Quote: We injected a conditional GCaMP expressing AAV virus (AAV9:FLEX:GCaMP6s; Addgene Plasmid #:100845; Chen, et al., 2013) in the AOB (Bregma 3.5 ...
-
bioRxiv - Bioengineering 2023Quote: ... Plasmids encoding the spike glycoprotein of vesicular stomatitis virus (VSV-G) and Cas9 were obtained from Addgene (cat ...
-
bioRxiv - Neuroscience 2023Quote: AAV5.CaMKII.GCaMP6f.WPRE.SV40 was the adeno-associated virus (AAV) used for calcium imaging and was obtained from Addgene at 2.3e13 GC-ml ...
-
bioRxiv - Neuroscience 2023Quote: ... The organoids were transduced with the AAV-hSYN-GFP virus two weeks before DIV70 (Addgene, 105539-AAV1). We dissociated the transduced organoids using papain digestion (Worthington ...
-
bioRxiv - Neuroscience 2024Quote: ... The dLight virus (700 nL of AAV5-hSyn-dLight 1.2; Addgene, Watertown, MA; Catalog No.111068-AAV5) was injected unilaterally into the NAc core (in mm ...
-
bioRxiv - Microbiology 2019Quote: ... cerevisiae ABC16-Monster strain using vectors p414 and p426 obtained from the Church lab (Addgene) as previously described72 ...
-
bioRxiv - Developmental Biology 2022Quote: E.coli strain BL21-DE3 was transformed with plasmid DNA pAG-MNase-6xHis (Addgene, plasmid #123461). Recombinant pAG-MNase was purified from cells grown in LB medium to OD600 0.6 at 37°C ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... strain PCC 7120 MurE WP_010995832.1 Q8YWF0|MURE_NOSS1) were inserted into the vector pPROEX HTa (Addgene) in order to be expressed in frame with an amino terminal ...
-
bioRxiv - Immunology 2022Quote: ... coli strain harboring a plasmid with the ilux operon (ilux pGEX(−)) was obtained from Addgene (plasmid # 107897 ...
-
bioRxiv - Molecular Biology 2020Quote: ... strains of interest were transformed with a plasmid containing His-tagged SUMO (Smt3-Hisx7) (Addgene) under the control of a copper inducible promoter ...
-
bioRxiv - Neuroscience 2019Quote: ... double inverted open (DIO)-reading frame adeno-associated virus (AAV): AAV5-hSyn-DIO-hM4D(Gi)-mCherry (Addgene; #44362) or AAV5-Ef1a-DIO-Cherry (UNC viral vector core ...
-
bioRxiv - Neuroscience 2020Quote: Recombinant adeno-associated virus carrying the GCaMP6f gene (AAV2/1:hSyn-GCaMP6f) was obtained from Addgene (100837-AAV1) with titer ≥ 1×1012 ...
-
bioRxiv - Neuroscience 2021Quote: ... 450nl of a mostly anterograde virus containing the Cre recombinase under CamKII promoter to target pyramidal cells (AAV1_CamKII_Cre_SV40, Addgene, USA) was injected into the right MEC (+3.2mm laterally from Lambda along the lambdoid suture and DV -2.5mm from skull level) ...
-
bioRxiv - Neuroscience 2020Quote: ... mice were injected with the virus encoding AAV9.CaMKII.GCaMP6f (pENN.AAV.CamKII.GCaMP6f.WPRE.SV40, gift from James M. Wilson, Addgene viral prep # 100834-AAV9) at the following coordinates ...
-
bioRxiv - Biochemistry 2021Quote: Tobacco Etch Virus protease (TEV) was a gift from Helena Berglund (Addgene plasmid # 125194; http://n2t.net/addgene:125194; RRID:Addgene_125194)40 ...
-
bioRxiv - Neuroscience 2022Quote: ... 70–100 nl of AAV5-CaMKIIa-hChR2(H134R)-EYFP (UNC vector core, Karl Deisseroth virus stock/ Addgene #26969) was injected into either the ventral (AP = −2.8 – −3.1 mm ...
-
bioRxiv - Neuroscience 2021Quote: ... The visual cortex was injected with a total of 2–3 μl of virus solution (1e13 GC/ml) containing AAV9-Syn-GCaMP6s.WPRE.SV40 (Penn Vector Core or Addgene) through a beveled glass micropipette (tip size 10–20 μm diameter ...
-
bioRxiv - Neuroscience 2022Quote: ... 100-200 nl virus solution of 3-5 × 1010 genome copies containing AAV5.gfaABC1d.Lck-GCaMP6f (Addgene, MA, USA) were injected at two or three sites in the craniotomy site at the cerebellar cortex (Vermis Lobule 4/5 ...
-
bioRxiv - Neuroscience 2023Quote: ... Adeno-associated virus for expressing GcaMP7f or 8f under the synapsin-1 promoter (AAV1-syn-jGCaMP7f-WPRE; Addgene 104488 ...
-
bioRxiv - Neuroscience 2023Quote: ... the Cre-dependent construct pAAV_hSyn1-SIO-stGtACR2-FusionRed packaged in an adeno-associated virus (AAV1, #105677-AAV1, Addgene) was injected into primary somatosensory cortex (S1 ...
-
bioRxiv - Neuroscience 2023Quote: ... we performed an additional control experiment in which we injected a cre-dependent mCherry virus (pAACV-hSyn-DIO-mCherry; a gift from Bryan Roth; Addgene plasmid #50459; http://n2t.net/addgene:50459; RRID:Addgene_50459) into the basal forebrain of 3 ChAT-cre mice ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV-DJ-hSYN1::mTurquoise2 (Produced by Stanford University Neuroscience Gene Vector and Virus Core using Addgene, plasmid #99125), AAV-DJ-hSYN1::mCherry (Stanford University Neuroscience Gene Vector and Virus Core ...
-
bioRxiv - Neuroscience 2024Quote: ... We injected in that region 3x750nL of an adeno-associated virus (AAV) mix of AAV1.Syn.GCaMP (6m: Addgene 100841 or 7f ...
-
bioRxiv - Cancer Biology 2024Quote: ... Whole cell lysates (200 µg) were incubated with GST-RAF-RBD (Addgene) bound to glutathione agarose beads at 4°C for 1 hour ...
-
bioRxiv - Neuroscience 2021Quote: ... a second surgery was performed and 300 nl of rabies SAD.B19.EnvA.ΔG.mCherry (SAD-B19 strain, Addgene Cat# 32636 prepared by the Salk institute vector core ...
-
bioRxiv - Cell Biology 2021Quote: ... coli strain was transformed with the pBAD::mRFP1 plasmid (Addgene plasmid #54667; Campbell et al., 2002) or the pZsGreen vector (cat ...
-
bioRxiv - Cell Biology 2022Quote: ... strain MB921 was transformed with PCR product obtained using plasmid pFA6a-GFP(S65T)-kanmx6 (Addgene 39292) and oligonucleotide primers Cut7-Cterm-pFA6a-GFP/paGFP-F and Cut7-Cterm-pFA6a-GFP/paGFP-R ...
-
bioRxiv - Cell Biology 2022Quote: ... strain MB1147 was transformed with PCR product obtained using plasmid pFA6a-GFP(S65T)-kanmx6 (Addgene 39292) and oligonucleotide primers Cut7-988-Cterm-pFA6a-GFP-F (TTAAAGGGAACGACATCACTTGCTAATCATACTAATGAATTACTTGGTTTAG-GAGATGAACGGATCCCCGGGTTAATTAA ...
-
bioRxiv - Biochemistry 2023Quote: ... the strain was transformed with the TRP1-GAL1 cassette from pFA6-TRP1-PGAL1 (RRID:Addgene_41606, ref. (76)) ...
-
bioRxiv - Microbiology 2020Quote: ... The plasmid used for constructing recombinant virus was pVSVΔG-eGFP (where eGFP is enhanced green fluorescent protein; plasmid 31842; Addgene). GPC was cloned into the ΔG site ...
-
bioRxiv - Neuroscience 2021Quote: ... the barcoded rabies virus plasmid library (131.36 mg) and CAG-promoter driven plasmids for T7 polymerase (23.66 mg, Addgene 59926) and SAD-B19 helper proteins (N ...
-
bioRxiv - Neuroscience 2021Quote: ... 200 nl of the adeno-associated virus (AAV) AAV1-SynGCaMP6s (diluted to 2.9×1012 GC/ml, Addgene 100844-AAV1) was injected into right motor cortex (1.6 mm lateral ...
-
bioRxiv - Neuroscience 2020Quote: ... hippocampal slice cultures were microinjected in the CA3 area with an adeno-associated virus (AAV7 or AAV9) to express either ChR2 ET-TC60 (RRID:Addgene_101361) or ChrimsonR61 (RRID:Addgene_59171 ...
-
bioRxiv - Neuroscience 2021Quote: ... Black-6 mice were first injected with 120nL of a retrograde virus encoding Cre (AAVrg-Ef1a-mCherry-IRES-Cre, titer of 1.37 x 10^13, Addgene viral prep # 55632-AAVrg ...
-
bioRxiv - Neuroscience 2019Quote: ... Virus injections per mouse pup were in a total volume of 4μL of AAV9-syn-GCaMP6s (Addgene, MA, USA) with a titer of 1Χ1013 vg/mL ...
-
bioRxiv - Cancer Biology 2019Quote: Brunello and Calabrese CRISPR guide virus libraries were obtained from the Broad Genomic Perturbation Platform (also available from Addgene). The pXPR_003 ...
-
bioRxiv - Microbiology 2020Quote: All virus-like particles were generated in HEK293T cells via calcium phosphate transfection using packaging plasmids psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259) ...
-
bioRxiv - Neuroscience 2020Quote: ... A pulled glass pipette front-loaded with virus carrying GCaMP6f (AAV1-hSyn-GCaMP6f-WPRE-SV40, 2.3 × 1013 gc/mL, catalog # 100837-AAV1, Addgene) was lowered into GC (1.9-2.0 mm below the dura ...
-
bioRxiv - Microbiology 2021Quote: ... vector pCMV-VSV-G for expression of the protein G from vesicular stomatitis virus (# 8454) were obtained from Addgene; reporter plasmids pUCHR-inLuc-mR and pUCHR-IR-GFP were described previously 37,38 ...