Labshake search
Citations for Addgene :
251 - 300 of 1992 citations for Mouse Anti HIV 1 p24 Recombinant Antibody clone 183 H12 5C since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: Mouse Two Plasmid Activity-Optimized CRISPR Knockout Library (Addgene#1000000096) was amplified in E coli ...
-
bioRxiv - Cancer Biology 2024Quote: The mouse GeCKO v2 library was obtained from Addgene (#1000000052). LentiCRISPRv2 is a one-vector plasmid system for the mouse GeCKO (Genome-scale CRISPR Knockout ...
-
bioRxiv - Biophysics 2023Quote: ... Mouse TRPM5 in pcDNA3.1 was purchased from Addgene (plasmid #85189), human TRPM5 in pcDNA3.1+ (Accession No ...
-
bioRxiv - Molecular Biology 2023Quote: ... untagged mouse cDNA into a pBig1a vector70 (Addgene, Plasmid #80611). These untagged RING1B and BMI1 constructs were used for all experiments presented in this manuscript with the exception for the data presented in Figure 6C ...
-
bioRxiv - Cancer Biology 2024Quote: ... FLAG-tagged mouse Fgfr2 cDNA was cloned into LentiV_Blast (Addgene_111887) using Gibson assembly (NEB).
-
bioRxiv - Molecular Biology 2022Quote: Trl gene and ~1kb flanking genomic sequence was cloned from a BAC genomic clone (BACR11B23) into pattB (backbone taken from pattB-aubergine-ADH-gf, Addgene plasmid # 69448 ...
-
bioRxiv - Neuroscience 2021Quote: ... The clone with the desired sequence and highest DNA concentration was used for subcloning into the pDESTSplice expression vector (Addgene) using the LR-Gateway System (Invitrogen).
-
bioRxiv - Cancer Biology 2020Quote: Single-cell clones of Cas9-expressing CALM-AF10 cells were established by cloning in a Lenti-Cas9-2A-Blast vector (Addgene: #73310 ...
-
bioRxiv - Cancer Biology 2022Quote: MLH1 KO cell line clones were generated by transient transfection of a Cas9-T2A-EGFP expression plasmid (Addgene Plasmid #48140), with co-expression of an MLH1-targeting gRNA (5’-GCACATCGAGAGCAAGCTCC-3’) ...
-
bioRxiv - Biochemistry 2020Quote: ... amplifying the vector from existing clone DU67810 (pET15D Twinstrep 3C 6His) and the Nsp3 179-1329 insert sequence from Addgene plasmid 141257 pDONR207 SARS-CoV-2 Nsp3.
-
bioRxiv - Biochemistry 2021Quote: ... Vector pREXNH3CA used to clone EfrCD in frame with a C-terminal Avi-tag was constructed from pREXNH3 (Addgene #47079) by PCR amplification with 5’ phosphorylated primers pREXNH3(newAvi_5’P)_FW (5’-aga aaa tcg aat ggc acg aaT AAT AAC TAG AGA GCT CAA GCT TTC TTT GA ...
-
bioRxiv - Molecular Biology 2022Quote: ... Entry clones were recombined with MSCV-N-Flag-HA-IRES-PURO(54) (a gift from Wade Harper, Addgene plasmid # 41033) using Gateway LR Clonase II (Life Technologies) ...
-
The haplolethal gene wupA of Drosophila exhibits potential as a target for an X-poisoning gene drivebioRxiv - Genetics 2024Quote: The design protocol of Port and Bullock (2016) was used to clone gRNA sequences into the pCFD5_w plasmid (Addgene #112645). Three separate plasmids were generated that targeted haplolethal genes on the X chromosome ...
-
bioRxiv - Microbiology 2023Quote: ... gRNA oligos + PAM sequence from Integrated DNA Technologies (IDT) to clone into the lentiCRISPR v2 that was a gift from Feng Zhang (Addgene plasmid # 52961 ...
-
bioRxiv - Biophysics 2023Quote: ... The cDNA clones were amplified by polymerase chain reaction and subcloned into pLV-EF1a-IRES plasmid-blast vector (Addgene #85133), which we further engineered to introduce the HaloTag sequence for N-terminal tagging ...
-
bioRxiv - Plant Biology 2024Quote: ... Golden gate reactions were performed to clone the 33 candidate genes and GFP into the pHREAC vector (Addgene; plasmid #134908) or a modified pHREAC containing BsmBI site instead of BsaI ...
-
bioRxiv - Cancer Biology 2022Quote: Guides were quantified against the Yusa Mouse V2 library (Addgene #67988) using crisprReadCounts v1.3.1 (https://github.com/cancerit/crisprReadCounts) ...
-
bioRxiv - Neuroscience 2020Quote: ... Mouse nAChR alpha4 CFP was a gift from Henry Lester (Addgene plasmid # 15244 ...
-
bioRxiv - Biochemistry 2021Quote: Mouse Bpnt2 cDNA was cloned into the pBABE-puro (Addgene #1764) retroviral vector using BamHI and SalI restriction sites ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... a mouse KO sgRNA pooled library (Addgene: #1000000096, 10sgRNA per gene) was amplified at 1000X fold coverage ...
-
bioRxiv - Physiology 2020Quote: ... the mouse N-Shh sequence was then cloned in pRRLsin.MND.MCS.WPRE (Addgene) that had been previously digested by NheI and PmlI ...
-
bioRxiv - Cell Biology 2022Quote: Mouse SEPT6-GFP construct was purchased from Addgene (Addgene plasmid# 38296) and was cloned into the pLVX-IRES-puro vector (Clontech) ...
-
bioRxiv - Immunology 2023Quote: pcDNA3-N-Flag-NLRP3 plasmid encoding mouse NLRP3 (Addgene plasmid # 75127) was a gift from Bruce Beutler61 ...
-
bioRxiv - Molecular Biology 2023Quote: The Mouse Improved Genome-wide Knockout CRISPR Library v2 (Addgene #67988) collection sgRNAs in lentiviral vectors targeting 18 ...
-
bioRxiv - Synthetic Biology 2024Quote: Mouse WNT5A was amplified from plasmid pRK5-mWnt5a [bought from Addgene, catalog number #42279] ...
-
bioRxiv - Synthetic Biology 2024Quote: ... mouse SOX9 was amplified from plasmid tetO.Sox9.Puro [bought from Addgene, catalog number #117269] ...
-
bioRxiv - Cell Biology 2024Quote: ... An entry vector containing mouse mfge8/LactC1C2 coding region (Addgene #52987) (MAPES et al ...
-
bioRxiv - Genetics 2021Quote: ... for the deletion step using a one-step cloning reaction as described by the Thomas lab 25 The same protocol with the minor modification of replacing the second oligo with water during ligation was used to clone the syn-sgRNAs into pX459 (Addgene #62988). A cloning mixture volume of 5μL or 10μL was then transformed into 25μL or 50μL ...
-
bioRxiv - Immunology 2020Quote: ... Human orfeome clone 10217) was gateway cloned into an attR-destination vector encoding an N-terminal FLAG tag (Addgene, Plasmid #18700), with the Gateway™ LR Clonase™ II Enzyme mix (ThermoFisher ...
-
bioRxiv - Microbiology 2020Quote: ... the SLC35B2 clones have been generated into HCT116cas9 cells that are expressing mCherry and Citrine due to integration of miReporter-PGK (Addgene#82477).
-
bioRxiv - Cancer Biology 2022Quote: ... we used the Gateway recombination system to introduce the following Myc ORF clone HsCD00039771 in pDONR221from the CCSB Human ORFeome Collection into pHAGE-TRE-DEST-NBioTAP (Addgene #53568) and pHAGE-TRE-DEST-CBioTAP lentiviral vectors (Addgene #53569) ...
-
bioRxiv - Cell Biology 2020Quote: HAP1 wt cells as well as single cell-derived clones were obtained from Haplogen Genomics or generated in-house by transient transfection with px459 (Addgene #48139) vectors carrying sgRNAs against the selected genes ...
-
bioRxiv - Cell Biology 2020Quote: ... was made by amplifying TPD54 by PCR from human Tumor protein D54 (IMAGE clone: 3446037) and inserting into pIRES-EGFP-puro (Addgene #45567) via NheI and XhoI ...
-
bioRxiv - Cell Biology 2021Quote: ... MDA-MB-231 CRISPR/Cas9 edited cell lines were generated by first isolating clones with doxycycline-inducible expression of Cas9 (Addgene, 50661), then infected with lentivirus harboring the sgRNA and selected with 4 μg/ml blasticidin ...
-
bioRxiv - Plant Biology 2022Quote: ... Entry clones were assembled in an empty rBiFC destination vector (pBiFCt-2in1-CC, Addgene 105114 or pBiFCt-2in1-NC, Addgene 105112) with a Gateway LR recombination reaction and selected using LB containing spectinomycin and XgalI ...
-
bioRxiv - Plant Biology 2023Quote: ... an expression clone was generated by cloning the tdT coding sequence (amplified from an AddGene-derived plasmid (Shaner et al., 2004)) into the BglII cloning site of plasmid pLAU2 using Gibson assembly (Idnurm et al. ...
-
bioRxiv - Genomics 2023Quote: ... The transgene was constructed using the Gateway recombination system to introduce the Myc ORF clone HsCD00039771 in pDONR221from the CCSB Human ORFeome Collection into the pHAGE-TRE-DEST-NBioTAP (Addgene #53568) lentiviral vector ...
-
bioRxiv - Cancer Biology 2023Quote: ... (NM_004458) Human Tagged ORF Clone (cat# RC205356) plasmids and cloned into a 3rd generation lentiviral vector PLJM1-EGFP (Addgene, cat# 19319). The control and ERBB2 OE cells were generated using retroviral vectors pBABE-puro (Addgene ...
-
bioRxiv - Cancer Biology 2024Quote: shRNAs targeting luciferase (shLuc) or murine Psat1 (shPsat1) (clone #640) were cloned into a doxycycline (doxy)-inducible EZ-tet-pLKO-Puro vector (Addgene #85966). Lentiviral particles were generated by transfecting 293T cells with 1.5 µg ps-PAX2 (Addgene #12260) ...
-
bioRxiv - Cancer Biology 2024Quote: ... a NALM-6 clone bearing an integrated doxycycline-inducible Cas9 expression cassette generated by lentiviruses made from pCW-Cas9 (Addgene #50661) was transduced with the genome-wide KO EKO sgRNA library83 (278,754 different sgRNAs) ...
-
bioRxiv - Developmental Biology 2020Quote: ... DBD and AD sequences along with the Drosophila synthetic minimal core promoter (DSCP) region were amplified using PCR from vectors pBPZpGal4DBDUw and pBPp65ADZpUw (Addgene clone 26234) using primers that added NotI and AvrII restriction sites (CTGATCGCGGCCGCAAAGTGGTGATAAACGGCCGGC and GATCAGCCTAGGGTGGATCTAAACGAGTTTTTAAGCAAACTCAC) ...
-
bioRxiv - Cancer Biology 2020Quote: ... U-2OS-SEC (Stably Expressing inducible Cas9) clones were generated by lentiviral infection with TLCV2 vector (a kind gift from Adam Karpf, Addgene plasmid #87360) followed by puromycin selection (1µg/ml) ...
-
bioRxiv - Bioengineering 2021Quote: ... and Tspan12 were gifts from Jeremy Nathans and the human ACE2 clone (Shang et al., 2020) was obtained from Addgene (code 145033). Synthetic DNA fragments of engineered VH containing SARS-CoV-2 RBD (resi 333-527 ...
-
bioRxiv - Molecular Biology 2020Quote: ... EJ5-GFP HCT116 cells and EJ5-GFP U2OS reporter cells were similarly generated by selecting stable clones after electroporation of HCT116 and U2OS cells with XhoI linearized pimEJ5-GFP (25) (Addgene, plasmid 44026) DNA ...
-
bioRxiv - Genomics 2023Quote: ... For the rescue experiment CTCF pLoF clones C13 and C21 were transfected with either pKS004-pCAGGS-3XFlag-CTCF-eGFP plasmid (a gift from Elphege Nora, Addgene plasmid #156438) [53] or GFP-NLS (a plasmid expressing GFP fused to a nuclear localization signal that was a gift from Michael Bustin ...
-
bioRxiv - Developmental Biology 2023Quote: Riboprobes for in situ hybridization were synthesized using the oligonucleotide primers listed in Supplementary Table 4 to clone the DNA fragment of interest into vector pJC53.2 (Addgene Plasmid ID: 26536), followed by riboprobe synthesis previously described 80.
-
Lysyl oxidase regulates epithelial differentiation and barrier integrity in eosinophilic esophagitisbioRxiv - Cell Biology 2023Quote: Lentiviral vectors pLX304-eGFP and pLX304-LOX were constructed by Gateway LR reaction of entry clones pENTR223-LOX (HsCD00378945, PlasmID Harvard Medical School) and pDONR221-eGFP (Addgene vector 25899) with destination vector pLX304 (Addgene vector 25890) ...
-
bioRxiv - Immunology 2023Quote: ... ICAM1 knockout was made by first cloning an ICAM1-targeting sgRNA into a modified lentiCRISPRv2 plasmid with an RFP reporter instead of puromycin (RFP subclone kindly provided by Prof. Ravindra Majeti; original clone was a gift from Feng Zhang, Addgene plasmid #52961). Third generation lentivirus was produced as described16 ...
-
bioRxiv - Cell Biology 2023Quote: Stable MEL cell clones expressing dCAS9-KRAB were generated using Lenti-dCAS9-KRAB-blast (Gift from Dr. Gary Hon, Addgene plasmid #89567). 2 × 106 of MEL cells were suspended in 100ul of High-Performance Electroporation Solution (BTXpress ...
-
bioRxiv - Genetics 2020Quote: Mouse Arid1a gRNA (GCTGCTGCTGATACGAAGGTTGG) was cloned into LentiGuide-puro plasmid (Addgene #53963). LentiCas9-Blast plasmid was purchased from Addgene (Addgene #53962) ...