Labshake search
Citations for Addgene :
251 - 300 of 2049 citations for Integrin beta 1 binding protein 1 ITGB1BP1 Antibody Biotin since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... pLVX-FLAG-dTomato-centrin-1 (Addgene,#73332), pLentiPGK DEST H2B-iRFP670 (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: ... and empty pKLO.1-hygro (Addgene, 24150) were used as negative controls.
-
bioRxiv - Cancer Biology 2023Quote: ... pMD2.G (1 µg; Addgene, Cat# 12259) and psPAX2 (2 µg ...
-
bioRxiv - Cancer Biology 2023Quote: ... LV-Cre pLKO.1 (Addgene plasmid 25997), which encodes Cre-recombinase in the backbone of the pLKO.1 vector ...
-
bioRxiv - Cancer Biology 2023Quote: ... and inserted into pLKO.1 Vector (Addgene). To package the third generation lentiviral vectors ...
-
bioRxiv - Immunology 2023Quote: ... pLenti CMV rtTA3 Blast (Addgene w756-1) stably expressing clonal RAW MΦs were transduced with pLenti CMV Puro DEST (Addgene w118-1 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 μg of pMD2.G (AddGene, #12259), and 1.5 μg of psPAX2 (AddGene ...
-
bioRxiv - Developmental Biology 2024Quote: ... and peroximal targeting signal 1 (Addgene, 54520) were cloned into mCherry-bearing pcDNA6 (Golgi-mCherry and PEX-mCherry) ...
-
bioRxiv - Neuroscience 2024Quote: ... or pLKO.1-TRC-control (Addgene_#10879) (Moffat et al. ...
-
bioRxiv - Molecular Biology 2024Quote: ... vector backbone carrying spCas9 cDNA from Addgene #48138 and mCat-1 cDNA from Addgene #17224 (see Note 1).
-
bioRxiv - Neuroscience 2024Quote: ... AAV-2/1/CAG-Flex-EGFP (Addgene), pENN.AAV.hsyn.Cre.WPRE.hGH (AAV1 ...
-
bioRxiv - Neuroscience 2024Quote: ... HIV-1 Rev (pRSV-Rev Addgene: 12253), and VSV g-glycoprotein Env (pMD2.G Addgene ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 μg of pMD2.G (AddGene, #12259), and 1.5 μg of psPAX2 (AddGene ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV9.hSyn.GRAB_DA2h (1 x 1013GC/mL, Addgene) was used to detect dopamine (Sun et al. ...
-
bioRxiv - Immunology 2024Quote: ... 1 μg of pMDLg/pRRE (Addgene #12251), and 1 μg of pRSV-Rev (Addgene #12253) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... We used plasmid 1 (Addgene #176640 (21)) as the base plasmid for Library 1 ...
-
bioRxiv - Genetics 2024Quote: ... and 1 µg of Flippase (Addgene 1379382) recombinases were transfected ...
-
bioRxiv - Cancer Biology 2024Quote: ... The pLKO.1-TRC cloning vector (Addgene), psPAX2 (Addgene ...
-
bioRxiv - Cancer Biology 2024Quote: ... Vector PLKO.1 Neo (shCtrl; Addgene, 13425) and Egfp open reading frame (Egfp OE ...
-
bioRxiv - Cell Biology 2024Quote: ... and pLKO.1-shDrp1-GFP (RRID: Addgene_228737).
-
bioRxiv - Neuroscience 2021Quote: ... The amplified fragments were inserted using KpnI and MluI sites into the pCAG vector backbone containing a zinc-finger binding site upstream of a CAG promoter prepared from pCAG-GPHN.FingR-EGFP-CCR5TC (Addgene #46296)17.
-
bioRxiv - Pathology 2021Quote: ... of adeno-associated virus serotype 8 encoding Cre recombinase under the hepatocyte-specific thyroid binding globulin promoter (AAV8-TBG-Cre) (Addgene) followed by a 12 days (12d ...
-
bioRxiv - Physiology 2021Quote: ... Adeno-associated virus serotype 8 (AAV8) with the thyroxine-binding globulin promoter (TBG) promoter expressing Cre (Addgene, AV-8-PV1091) were injected via tail vein at a dose of 1×1012 genomic copies per mouse on GD8 ...
-
bioRxiv - Genomics 2022Quote: ... was used to generate a list of all primers with one exact-match binding site on one of the plasmids and no exact-match binding site on the other plasmid (pcDNA3-EGFP and pLTR-RD114A from Addgene). The first round of experimental amplification used 204 primers from this list that maximized the variability in the 22 primer attributes in Table 2 ...
-
bioRxiv - Cell Biology 2022Quote: ... The pGEX2TK-Pak1 (70-117) containing the p21-binding domain (PBD) was a gift from Jonathan Chernoff (Addgene plasmid# 12217). For the purification of ARP3 (ACTR3) ...
-
bioRxiv - Plant Biology 2024Quote: ... For N-terminal fusions with the GAL4-activation or -binding domains the vectors pGADT7-GW and pGBKT7-GW (gift from Yuhai Cui, Addgene plasmids #61702 ...
-
bioRxiv - Cancer Biology 2024Quote: ... dominant negative N133I (GFP-Rab27B N133I, Adddgene plasmid #89449, and geranylgeranyl-binding mutant (GER) (GFP-Rab27B GG, Addgene plasmid #89451) were gifted by Wendy Westbroek (Reference) ...
-
bioRxiv - Plant Biology 2023Quote: The monocot nlsGPS-NR control sensor amino acid sequence contains the same four charge exchange mutations as the nlsGPS2 but with the additional NR mutations (S114A and F115A in the AtGID1C binding pocket). DR5v2-ntdTomato/DR5-n3GFP and R2D2 were previously described (Liao et al. 2015) and obtained from Addgene (DR5v2/DR5 catalog #61628 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The AND gate constructs were optimized by making constructs with ribosome binding site library (5’-GAAAGANNNGANNNACTA-3’) in front of regulators in chemically competent Marionette Clo cells prepared from Addgene [40] ...
-
bioRxiv - Biophysics 2024Quote: ... in combination with pBV-Luc BDS-2 3x WT (pBDS-2) (BDS-2 3x WT (p53 binding site) was a gift from Bert Vogelstein (Addgene plasmid #16515 ...
-
bioRxiv - Cell Biology 2024Quote: ... the second BsmBI site and the 3’ part of the padlock recognition sequence (ACTGGCTATTCATTCGC) followed by an RT primer binding site (CCTTTGGGTAAGCACACGTC) (Fig. 2B, plasmid deposited on Addgene). We then synthesized three pegRNA sublibraries corresponding to 48 ...
-
bioRxiv - Molecular Biology 2023Quote: ... the ORFs were cloned into plasmid H6-mCerulean (pET Biotin His6 TEV mCerulean LIC cloning vector, Addgene plasmid #29726). In the second step ...
-
bioRxiv - Cancer Biology 2020Quote: ... pLenti CMV rtTA3 Blast (w756-1) and pLenti CMVTRE3G eGFP Neo (w821-1) were gifts from Eric Campeau (Addgene plasmids #26429 and #27569 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The two configurations that enabled efficient packaging of full-length vector genomes (designs 1 and 4) are available on Addgene (pEJS1099: Dual-sgRNA:Design 4, Addgene #159537; pEJS1096: Dual-sgRNA:Design 1, Addgene # 159538). Oligonucleotides with spacer sequences for target genes were inserted into the sgRNA cassette by ligation into the BspQI and BsmBI cloning sites.
-
bioRxiv - Cell Biology 2021Quote: ... Cells settled to the bottom of the well for 5 minutes at room temperature and then 0.25 μL of F-OKMS lentiviral mix (1:1 of Addgene plasmids 51543 ...
-
bioRxiv - Cell Biology 2022Quote: ... The lentiviral particles of shZDHHC5 (target sequence 5’CCCAGTTACTAACTACGGAAA3’ in pLKO.1 vector) and empty pLKO.1 (Addgene, 8453) were packaged in HEK293T cells and used to transduce PCDH7-GFP-BAC cells ...
-
bioRxiv - Molecular Biology 2020Quote: ... NSUN6 knockdown mediated by shRNA was performed using pLKO.1-blast plasmid (modified from pLKO.1-puro, #10878, Addgene) with following shRNAs ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.8 uL of a 1:1 mixture of EGFP (AAV9- Hsyn-DIO-EGFP;4.6*10^13 GC/mL; Addgene) and AAV8-GAD1-cre was injected unilaterally into VP ...
-
bioRxiv - Genomics 2024Quote: ... the 1 μg of total DNA was split in a 1:15 ratio of pCAG-NLS-Bxb1 (Addgene #51271) and recombination vector ...
-
bioRxiv - Cancer Biology 2024Quote: Viral particles were packaged in HEK293T cells by transfecting the pLKO.1-shCYB561 constructs or scrambled shRNA pLKO.1 (RRID:Addgene_1864) (30 ...
-
bioRxiv - Microbiology 2023Quote: ... pLentiCMVPuroDEST (w118-1) and pLentiCMVHygroDEST (w117-1) were gifts from Eric Campeau & Paul Kaufman (Addgene plasmids #17452 and #17454) [33] ...
-
bioRxiv - Genomics 2022Quote: ... Each 15-cm2 plate was transfected with a total of 21 μg of plasmid DNA (1:2:1 ratio psPAX2-D64V:pLenti-STARR:pLAI-Env) [psPAX-D64V (Addgene #63586), and pLAI-HIV (Addgene #133996)] ...
-
bioRxiv - Developmental Biology 2023Quote: ... animals were injected with a target transgene (50 ng μl-1) with plasmid pJL43.1 (50 ng μl-1) (Addgene) that expresses MosTase under a germline promoter and plasmid pMR910 (20 ng μl-1 ...
-
bioRxiv - Neuroscience 2023Quote: ... or a 1:1 combination of GCaMP6f+hM4Di-mCherry (same as used for behavior, AAV8-CaMKIIa-hM4Di-mCherry, Addgene).
-
bioRxiv - Neuroscience 2024Quote: ... using a Hamilton Neuros syringe filled with a viral cocktail mixture (1:1) of AAV8 HSyn-Con/Fon-YFP (2.4e13 vg/mL, Addgene) and AAV8 Ef1a-Coff/Fon-mCherry (2.2e13 vg/mL ...
-
bioRxiv - Immunology 2024Quote: hPD-1 retroviral plasmid was generated by inserting hPD-1 cDNA into MSCV-IRES-Thy1.1 DEST (Addgene, catalog# 17442). Point mutations were introduced by using QuikChange ll site-directed mutagenesis kit (Agilent ...
-
bioRxiv - Biochemistry 2024Quote: ... pLKO.1 puro CXCR4 siRNA-1 and siRNA-2 were gifts from Bob Weinberg (Addgene plasmids #12271 and #12272). plKO.1 scramble shRNA was a gift from David Sabatini (Addgene plasmid #1864) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Three elements of the reporter were amplified from the following sources: five TetO binding sites upstream of a pEF promoter from PhiC31-Neo-ins-5xTetO-pEF-H2B-Citrine-ins (Addgene #78099), TagRFP-T from pEN_ERK.KTR-tagRFP-T ...
-
bioRxiv - Cell Biology 2021Quote: ... the cytosolic domain of Miro1 (Miro1(ΔTM)) and the iLID binding peptide (SspB, obtained from Addgene #60415, gift from B. Kuhlman) were fused into pmCherry-C1 using EcoRI and KpnI ...
-
bioRxiv - Neuroscience 2024Quote: ... we cloned CreERT2 (Cre recombinase fused to a mutant ligand-binding domain of the estrogen receptor) and IRES into the BamHI site of pAAV-EF1a-tdTomato-WPRE-pGHpA (Addgene #67527). To prevent leakage of Cre activity34 ...