Labshake search
Citations for Addgene :
251 - 300 of 2479 citations for Human V Set And Immunoglobulin Domain Containing Protein 2 VSIG2 CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... the murine shRNA hairpins pLKO.1-shCdkn2a #1 (TRCN0000077816) and #2 (TRCN0000362595) and the human and murine pLKO.1-shGFP control (Addgene, cat#30323) vectors were packaged using the ViraPower Kit (Invitrogen ...
-
bioRxiv - Molecular Biology 2021Quote: FUS-ΔIDR-SHARP was generated by recombining the ΔIDR-SHARP entry clone into a modified version of the PB-HALO-IRES-NGFR vector containing the IDR sequence from the FUS protein tagged with mCherry (Addgene plasmid 101223) in place of HALO ...
-
bioRxiv - Physiology 2023Quote: ... containing endothelial specific-promoter (CDH5, VE-Cadherin) and green fluorescent protein (GFP) and the plasmid pC4-RhE-FRB-Fis1 (Addgene Cat# 68056) containing human Fis1 gene were purchased from Addgene ...
-
bioRxiv - Cancer Biology 2020Quote: ... a sox10 minimal promoter was PCR amplified from genomic DNA from AB* larvae with primers (Table 1 and 2) containing overlapping nucleotides to sequences on either side of the AgeI site in pENTR-EGFP2 (Addgene #22450), similarly described in (Quillien et al. ...
-
bioRxiv - Biophysics 2022Quote: ... a pQE-30/pcl-ts ind+ plasmid containing a His6-SUMO SARS-CoV-2 nsp12 and untagged nsp7 & 8 (Addgene #160540) was transformed into E ...
-
bioRxiv - Neuroscience 2023Quote: ... transfection mix for each plasmid was prepared in the following manner: 1 µg of transfer plasmid and 2 µg of second-generation packaging DNA mix containing psPAX (Addgene #12260) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Biochemistry 2023Quote: The pET28-eGFP-SLAP was digested with BamHI and XhoI restriction enzymes and the SLAPTAG-containing band was subcloned into SARS-CoV-2 S HexaPro plasmid (Addgene#154754) with the same restriction sites.
-
bioRxiv - Cancer Biology 2023Quote: HEK293 cells were transfected with a mixture of the 3rd generation lentiviral packaging plasmids containing: 2 μg of Rev (pRSV-Rev, Addgene #12253), 2 μg of Gag and Pol (pMDLg/pRRE ...
-
bioRxiv - Neuroscience 2024Quote: ... that was first PCR amplified using custom primers (see Table 2) from a plasmid containing lexAop2 (lexAop2-myr-4xSNAPf, RRID: Addgene 87638) and then restriction digested using HindIII and PspXI (New England BioLabs ...
-
bioRxiv - Molecular Biology 2021Quote: ... and annealed oligos for MLL3 SET were inserted into pLH-spsgRNA2 vector (Addgene #64114) (Ma et al ...
-
bioRxiv - Cell Biology 2020Quote: Human SH3 domain nucleotides (hLynSH3, amino acids 63-123) were amplified by PCR and cloned into a mammalian expression vector pEBG (Addgene, plasmid # 22227) with an N-terminal glutathione S-transferase (GST ...
-
bioRxiv - Neuroscience 2022Quote: ... Err2EnR was generated by fusing the open reading frame of the transcriptional repressor domain of Drosophila Engrailed (amplified from CAG-EnR plasmid, Addgene plasmid #19715, Addgene, Watertown, USA) to Err2.
-
bioRxiv - Genomics 2021Quote: Human codon-optimized optimized Streptococcus pyogenes dCas9 with two C-terminal SV40 NLSs was fused at the N-terminus to the ABI domain (gift from Jerry Crabtree, Addgene plasmid #38247) and tagBFP ...
-
bioRxiv - Biochemistry 2020Quote: ... coli RP hk339-GFP (monomeric His-tagged Kif5B kinesin motor domain) expression plasmid was a gift from Ron Vale (Addgene plasmid #24431).
-
bioRxiv - Molecular Biology 2022Quote: ... the ACE2 and its ECT/PD domains were cloned into pBiFC-VN155 (I152L) and pBiFC-VC155 vector(Kodama and Hu, 2010) (Addgene, MA, USA). The RBD ...
-
bioRxiv - Cell Biology 2022Quote: ... expressing myristoylated FGFR1 cytoplasmic region fused with the PHR domain of cryptochrome2 and mCitrine (gift from Won Do Heo (Addgene plasmid # 59776), (Kim et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... Chimeras of the minimal domain (NTD) ORF24 homologs with ORF24 202-752 were generated using two-insert InFusion cloning (Addgene #138453-138455) into BamHI/XhoI-cut pcDNA4/TO-2xStrep (C-terminal tag).
-
bioRxiv - Pathology 2019Quote: ... antisense: CGAGTTCATGACGGCGCGCA) targeting the DID domain region of INF2 was expressed using a lentiviral plasmid (Cat. no:5296, lentiCRISPRV2, Addgene, Boston, MA). All cloned plasmids were confirmed for the correct sequence by DNA sequencing (Genewiz ...
-
bioRxiv - Synthetic Biology 2019Quote: ... AcrIIC3-LOV2 hybrid constructs were created by inserting the LOV2 domain into our published CMV-driven AcrIIC3 expression vector (Addgene plasmid #120301) (51) ...
-
bioRxiv - Biochemistry 2023Quote: ... and the 6xHis-SUMO tag was removed by enzymatic cleavage using human Sentrin-specific protease 1 (SENP1) catalytic domain (derived from pET28a-HsSENP1, that was a gift from Jorge Eduardo Azevedo (Addgene plasmid #71465) at 4°C overnight27,28 ...
-
bioRxiv - Cell Biology 2023Quote: ... The KT binding domain sequence of 53BP1 (aa 1235-1616) was PCR-amplified from pcDNA5-FRT/TO-eGFP-53BP1 (Addgene plasmid #60813) and cloned into pB66 downstream to the Gal4 DNA-binding domain ...
-
bioRxiv - Developmental Biology 2023Quote: ... Full-length Sema6a cDNA or shortened Sema6a lacking the sequence coding for the intracellular domain (bp 2680-3766) were cloned into the pCAG-GFP vector (Addgene, Cat #11150) to obtain pCAG-promotor-driven expression of Sema6a and Sema6aΔcyt with a GFP signal sequence located upstream.
-
bioRxiv - Evolutionary Biology 2024Quote: ... we first replaced the SH3 domain with a flexible linker (GGSSGGGG) using yeast competent cells that were co-transformed with a pCAS plasmid (Addgene plasmid 60847) expressing both the gRNA of interest and Streptococcus pyogenes Cas9 and a donor DNA sequence (stuffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... AAVpro 293T cells were cultured in DMEM (FUJIFILM Wako Pure Chemical) supplemented with 10% (v/v) FBS (NICHIREI) and transfected with the pUCmini-iCAP-PHP.eB plasmid (Addgene), pHelper plasmid (Takara Bio ...
-
bioRxiv - Microbiology 2021Quote: ... pCDNA3.1-SARS2-Spike expressing full-lengh Spike (S) protein from SARS-CoV-2 (GenBank accession number QHD43416.1) was purchased from Addgene. Expression plasmid encoding S protein from SARS-CoV (GenBank accession number AAP13567.1 ...
-
bioRxiv - Systems Biology 2022Quote: ... or 1-2 x 105 cells/mL for pCL040-based inducible protein expression vectors (to be deposited on Addgene) to account for differences in infection efficiency ...
-
bioRxiv - Immunology 2023Quote: The expression construct used to generate SARS-CoV-2 spike protein was a gift from Jason McLellan (Addgene #154754). Spike protein was prepared as previously described in20 ...
-
bioRxiv - Biophysics 2023Quote: ... a pQE-30/pcl-ts ind+ plasmid containing a His6-small ubiquitin-like modifier (SUMO) SARS-CoV-2 nsp12 and untagged nsp7 and 8 (Addgene no. 160540) was transformed into Escherichia coli BL21 cells (Agilent) ...
-
bioRxiv - Cell Biology 2020Quote: ... Cilia-AMSH was generated by fusing the catalytic domain of mouse AMSH (gift from David Komander; Addgene plasmid #66712; (Michel et al., 2015) with NPHP3(1-200 ...
-
bioRxiv - Genetics 2022Quote: ... The ecDHFR degron domain was amplified from CAG-DDdCas9VP192-T2A-EGFP-ires-puro (Addgene plasmid # 69534; http://n2t.net/addgene:69534; RRID:Addgene_69534, a gift from Timo Otonkoski). The SMASh degron domain was amplified from pCS6-SMASh-YFP ...
-
bioRxiv - Plant Biology 2022Quote: ... while the full-length coding sequence of HlMYB7 was cloned into the prey vector pGADT7-GW [DNA-binding domain (BD)] (Addgene Inc, MA, USA) using the In-Fusion Snap Assembly Kit (Takara Bio) ...
-
bioRxiv - Microbiology 2020Quote: ... miniSOG-Alpha-V-Integrin-25 (Addgene plasmid # 57763)51 and Beta1-GFP in pHcgreen donated by Martin Humphries (Addgene plasmid # 69804)52 ...
-
bioRxiv - Immunology 2020Quote: ... DT40 CL18 Fam72a−/− cells were obtained by transfecting DT40 CL18 with Nucleofector™ Kit V four constructs in PX458 (Addgene, plasmid #48138) targeting Fam72a (1.5μg each ...
-
bioRxiv - Molecular Biology 2021Quote: ... Annealed oligos for MLL4 SET or p300 HAT were inserted into lentiCRISPRv2 vector (Addgene #52961) (Sanjana et al ...
-
bioRxiv - Neuroscience 2023Quote: A set of PV-IRES-Cre animals injected with AAV2.9-CAG-Flex-ArchT-GFP (Addgene, titer ≥ 1×10¹³ vg/mL ...
-
bioRxiv - Biophysics 2021Quote: ... were transfected in DMEM with 2 % (v/v) FBS with 12 μg of pHR-CMV-TetO2 construct vector alongside 11 μg envelope plasmid (pMD2.G; Addgene #12259) and 11 μg packaging plasmid (psPAX2 ...
-
bioRxiv - Microbiology 2021Quote: ... A plasmid encoding stabilized SARS-CoV-2 spike protein S-HexaPro (Hsieh et al., 2020) was a gift from Jason McLellan (Addgene plasmid #154754 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... cells were co-transfected using Lipofectamine 3000 and 15μg of DNA encoding for viral protein (pCMV14-3X-Flag-SARS-CoV-2 S was a gift from Zhaohui Qian - Addgene plasmid # 145780 ...
-
bioRxiv - Biophysics 2023Quote: ... and 15 µg of the plasmid encoding the respective viral surface protein (pCMV14-3X-Flag-SARS-CoV-2 S was a gift from Zhaohui Qian - Addgene plasmid # 145780 ...
-
bioRxiv - Microbiology 2021Quote: ... After annealing each set of oligonucleotides they were ligated into the lentiCRISPRv2 shuttle vector (Addgene, #52961) that was linearized with BsmBI (NEB ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Two DNA fragments were independently amplified with two primer sets (NLS_Fw1/Rv1, NLS_Fw2/Rv2) using pDest_pK7WG2_pRPS5A_CTP OleGFP (Addgene #171723) as a PCR template ...
-
bioRxiv - Developmental Biology 2021Quote: ... GST-human β-catenin (Addgene #24193), and NLS-mCherry (Addgene #49313 ...
-
bioRxiv - Molecular Biology 2022Quote: ... pscALPSpuro-HsACE2 (human) (Addgene, MA, USA) were co-transfected with psPAX2 and pCMV-VSV-G packaging plasmids into HEK293T cells using FuGENE 6 (Promega ...
-
bioRxiv - Neuroscience 2023Quote: ... human a-SYN (A53T mutant) (Addgene), and mt-Keima (Addgene) ...
-
bioRxiv - Biochemistry 2024Quote: Recombinant human GST-CK2α’ (Addgene #27084) and recombinant human GST-CK2α (Addgene #27083 ...
-
bioRxiv - Cancer Biology 2024Quote: ORF encoding human MARK2 (Addgene, 23404) was cloned into pFL system with an N-terminal Strep2SUMO tag ...
-
bioRxiv - Molecular Biology 2021Quote: ... The mammalian expression plasmid for RBD of SARS-CoV-2 protein S (spike) with 8xHis tag was obtained from Addgene (#145145). The mammalian expression vector for soluble ACE2 pcDNA3-sACE2 (WT)-sfGFP (#145171 ...
-
bioRxiv - Neuroscience 2023Quote: ... The construct encoding SARS-CoV-2 matrix (M) protein was cloned by PCR amplification of M cDNA from the pDONR 207 SARS-CoV-2 M plasmid (Addgene #141274) using a Forward primer inserting a restriction site for EcoRI and a reverse primer bearing a restriction site for BamHI and a Myc tag ...
-
bioRxiv - Microbiology 2023Quote: ... and pRN-Luc (50 ng) reporter plasmids in combination with S protein expressing plasmids pTwist-SARS-CoV-2 Δ18 D614G (Addgene, 164437) or pTwist-SARS-CoV-2 Δ18 B.1.1.529 (Addgene ...
-
bioRxiv - Cancer Biology 2020Quote: WM266-4 or SK-MEL-2 cells were co-transduced with conditioned media containing lentiviruses bearing Firefly luciferase-7TFP (Addgene #24308, β-catenin reporter) and Renilla luciferase pLenti.PGK.blast-Renilla Luciferase (Addgene #74444 ...