Labshake search
Citations for Addgene :
251 - 300 of 1837 citations for Cystatin C ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2023Quote: ... We first constructed pKB11 by replacing the TRP1 auxotrophic cassette of pDEST-DHFR F[1,2]-C (TRP1) (Addgene #177795) (Marchant et al ...
-
bioRxiv - Cell Biology 2024Quote: Plk1 FRET sensor c-jun substrate was a gift from Michael Lampson (Addgene plasmid #45203; http://n2t.net/addgene:45203; RRID:Addgene 45203). Cells were transiently transfected with a and plated onto glass-bottom plates ...
-
bioRxiv - Molecular Biology 2024Quote: ... The G418 (Geneticin) resistance gene was subcloned from pDEST-CMV-C-eGFP (a gift from Robin Ketteler, Addgene: 122844) and inserted into pLX303-DD-HA-ER-I-PpoI using In-Fusion cloning ...
-
bioRxiv - Neuroscience 2023Quote: ... mixed 1:1 with pAAV.CAMKII.Cre.SV40 (#105558; Addgene), or pAAV.CAG.GFPsm-myc.WPRE.SV40 (#98926 ...
-
bioRxiv - Microbiology 2022Quote: ... Cells were seeded in 96-well plates and transfected 24h after with pMXs GFP-LC3-RFP (#117413, Addgene, MA) or with Polyinosinic-polycytidylic acid sodium salt ...
-
bioRxiv - Neuroscience 2020Quote: ... Dissociated single cell forebrain NPCs were plated 1,000,000 cells/well on 12 well plates and transfected with lentiGuide-tdTomato (Addgene #99376) plasmid and selected by hygromycine ...
-
bioRxiv - Cell Biology 2019Quote: ... U2OS and HEK293 cells were seeded into 10 cm plates 24 h prior to transfection with 2.5 µg of the I-SceI expression vector pCBA-SceI (Addgene plasmid # 26477 ...
-
bioRxiv - Cell Biology 2023Quote: Cells in a 6-well plate (approximately 70% confluent) were transfected with 0.4ug of an Actin5C-EGFP plasmid (pAc5.1B-EGFP, Addgene #21181) using Effectene Transfection Reagent (Qiagen) ...
-
bioRxiv - Neuroscience 2020Quote: The TALEN kit used for TALE assembly was a gift from Keith Joung (Addgene kit # 1000000017). DNA fragments encoding ROSA TALEN repeat arrays were cloned into plasmid pJDS71 ...
-
bioRxiv - Plant Biology 2024Quote: We used zCas9i cloning kit: MoClo-compatible CRISPR/Cas9 cloning kit with intronized Cas9 (AddGene #1000000171). Sequence of all oligonucleotides and PCR primers used in this study are provided in Table S1 ...
-
bioRxiv - Plant Biology 2020Quote: ... from Sylvestre Marillonnet (Addgene kit # 1000000044). Specific parts (target gRNA or siRNA sequence ...
-
bioRxiv - Synthetic Biology 2022Quote: The MoClo Toolkit (Addgene Kit #1000000044), MoClo Plant Parts Kit (Addgene Kit #1000000047) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... GreenGate Cloning System (Addgene Kit #1000000036) and amilCP_Orange chromoprotein vector (Addgene Plasmid #117850 ...
-
bioRxiv - Genetics 2023Quote: ... and pX330S-2 (Addgene Kit 1000000055) according to the kit instructions ...
-
bioRxiv - Bioengineering 2024Quote: ... including existing parts (Addgene Kit # 1000000080) and custom-made parts (Table 2) ...
-
bioRxiv - Biochemistry 2024Quote: ... a ∼1:1:1 molar ratio mixture of library transfer (lentiCRISPRv2; Addgene plasmid #52961) and packaging plasmids (psPAX2 ...
-
bioRxiv - Biophysics 2021Quote: ... The pET C-terminal TEV His6 cloning vector with BioBrick polycistronic restriction sites (9Bc) was a gift from Scott Gradia (Addgene plasmid #48285 ...
-
bioRxiv - Biophysics 2022Quote: ... The plasmid MCherry-Actin-C-18 was a gift from Michael Davidson (Addgene plasmid 54967; http://n2t.net/addgene : 54967; RRID : Addgene_54967 [51]).
-
bioRxiv - Cell Biology 2022Quote: ... 5’-GGG GGG GGC GGA ATT CTC AGT CTA TCT TTT CTT TCT GGA CCA GTC TGG GAG C-3’ and pmScarlet-C1 (gift from Dorus Gadella; Addgene plasmid # 85042 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The expression vectors of the full-length SARS-CoV-2 spike and the human serine protease TMPRSS2 with a C-terminal C9-tag (TETSQVAPA) were acquired from AddGene (Summit Pharmaceutical International ...
-
bioRxiv - Biochemistry 2020Quote: ... To construct PTP1BPS* and PTP1BPS**, we amplified C-terminal regions of PTP1B (residues 299-405 and 299-435, respectively) from pGEX-2T-PTP1B (Addgene) and used Gibson assembly to join them to the C-terminus of PTP1BPS (50°C for 1 hr ...
-
bioRxiv - Neuroscience 2020Quote: ... The constructs were subcloned using restriction digestion into the pHL-sec vector containing a C-terminal 6xHis-tag (Addgene # 99845). Restriction sites for subcloning were introduced by PCR at the 5’ and 3’ ends of scFv-Clasp heavy and light chains (light chain ...
-
bioRxiv - Biophysics 2021Quote: The construct for the adaptor protein mTurquoise-SRC-N-18 (SRC with mTurquoise fused to its C-terminus via a linker) was a gift from Michael Davidson (Addgene plasmid # 55560 ...
-
bioRxiv - Bioengineering 2020Quote: Synthetic thermal switches were produced as gene blocks by IDT and cloned into the Lego-C backbone (Addgene plasmid #27348). The core promoters were truncated immediately upstream of their previously described TATA boxes at their 5’-termini and at their translational start site on their 3’-termini 76-78 ...
-
bioRxiv - Cell Biology 2021Quote: pTRIP-SFFV-EGFP-NLS and the coding sequences of mEmerald-Lamin A/C and mEmerald-Lamin B1 were from Addgene. pLVX-N-GFP was a kind gift from Prof ...
-
bioRxiv - Biochemistry 2022Quote: ... with an initial Met and a cleavable C- terminal TEV 6x-His tag was a gift from Ginkgo Bioworks (Addgene plasmid 145611 ...
-
bioRxiv - Biochemistry 2022Quote: ... with an initial Met and a cleavable C-terminal TEV 6x-His tag) was a gift from Ginkgo Bioworks (Addgene plasmid 145584 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and WPRE were cloned into the EcoRI site of pCCL-c-MNDU3-X (gift from Donald Kohn, Addgene plasmid #81071) or pMYs (Cell Biolabs ...
-
bioRxiv - Neuroscience 2021Quote: The guides were inserted into a deadCas9-KRAB-T2A-GFP lentiviral backbone containing both the guide RNA under the U6 promoter and dead-Cas9-KRAB and GFP under the Ubiquitin C promoter (pLV hU6-sgRNA hUbC-dCas9-KRAB-T2a-GFP was a gift from Charles Gersbach (Addgene plasmid #71237 ...
-
bioRxiv - Cancer Biology 2020Quote: ... SK-N-BE(2)-C cells were transduced with lentiviral constructs for stable expression of the different tested RRM2 promotor targeting sgRNAs (Addgene) (MP-I-1142 sg86RRM2 ...
-
bioRxiv - Microbiology 2022Quote: ... mEmerald-CLIP170-N-18 and mCherry-ATG3-C-18 were gifts from Michael Davidson (Addgene cat. 54967, 54044 and 54993) [63] ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and LY6C1 (NM_010741.3) were separately cloned into an expression vector backbone with a C-terminal Fc-tag (Addgene plasmid #115773) using Xbal/EcoRV ...
-
bioRxiv - Molecular Biology 2019Quote: ... The mammalian expression vector for St1Cas9 (LMD-9) fused to SV40 NLS sequences at the N- and C-terminus (MSP1594_2x_NLS; Addgene plasmid #110625) was constructed from MSP1594 (Kleinstiver et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... of a TubB1 sequence fragment synthesised as a gBlock by Integrated DNA Technologies (IDT) and a C-terminal mApple empty backbone (mApple-C1 was a gift from Michael Davidson (Addgene plasmid # 54631 ...
-
bioRxiv - Immunology 2021Quote: ... were co-electroporated with 5 µg of either pCB92-C*05 or pEx-CAG-KIR2DL1 and 5 µg of pPhiC31o (Addgene) using the Neon transfection system (Thermo Fisher ...
-
bioRxiv - Immunology 2021Quote: ... Full length FOXN1 cDNA without a stop codon was cloned into vector backbones positioning at its C-terminus either a flag (pCSF107mT-GATEWAY-3’-FLAG, Addgene), myc (pCSF107mT-GATEWAY-3’-Myc tag ...
-
bioRxiv - Immunology 2021Quote: ... The lentiviral HLA-C expression plasmids were co-transfected with the vesicular stomatitis virus-G envelope plasmid pMD2.G (Addgene) and packaging plasmid psPAX2 (Addgene) ...
-
bioRxiv - Neuroscience 2020Quote: ... membrane-trafficking optimized variant was generated by fusing an additional trafficking signal from the potassium channel Kv2.112 to the C-terminus of Chrimson (pAAV-hSyn-somBiPOLES-mCerulean; Addgene #154945). For expression in GABAergic neurons ...
-
bioRxiv - Genetics 2019Quote: ... Only a single site upstream of the c(3)GccΔ1 deletion was selected (AAAGCTTTGTTGGCCTGTATTGG) and constructed into the pU6-BbsI-chiRNA guide RNA (gRNA) plasmid (Addgene 45946). Sense (CTTCGAAAGCTTTGTTGGCCTCTAT ...
-
bioRxiv - Genetics 2019Quote: ... and guide 2 c(3)GccΔ3: TCTTGAACAACAATCTGTCAAGG) and constructed into the pU6-BbsI-chiRNA guide RNA (gRNA) plasmid (Addgene 45946). Sense and antisense oligonucleotides (guide 1 c(3)GccΔ2 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The GFP fragment was amplified and C-terminally Flag-tagged using primers GFP_IndOE_F & R and the construct pT2-CAG-fGFP (Addgene plasmid #108714) as template ...
-
bioRxiv - Biochemistry 2021Quote: ... Vector pREXNH3CA used to clone EfrCD in frame with a C-terminal Avi-tag was constructed from pREXNH3 (Addgene #47079) by PCR amplification with 5’ phosphorylated primers pREXNH3(newAvi_5’P)_FW (5’-aga aaa tcg aat ggc acg aaT AAT AAC TAG AGA GCT CAA GCT TTC TTT GA ...
-
bioRxiv - Synthetic Biology 2021Quote: ... or Omphalotin A (OphA) genes with C-terminal His-tags were cloned into the UTR1-T7RNAP-T500 plasmid backbone (Catalog No. 67739, Addgene). The T7 Max promoter was further cloned into these plasmids for downstream experiments ...
-
bioRxiv - Developmental Biology 2022Quote: ... or synthesized (NLS and N1ICD the fragment of [ENSMUST00000028288.5] encoding the C-terminal 789 AA of the Notch1 protein) and cloned with sequence encoding an N- or C-terminal eGFP into a modified version of pLKO.3G (Addgene, Cat #14748 ...
-
bioRxiv - Cell Biology 2022Quote: ... we added a signal peptide at the N-terminus of Breg and a 6×His tag at its C-terminus using pHL-sec vector (Addgene)39 ...
-
bioRxiv - Microbiology 2022Quote: ... C-terminal FLAG-tagged TMPRSS2 orthologues and the human ΔHDS mutant were ligated into the lentiviral pWPI-BLR vector (Addgene) via restriction digestion or using HiFi Builder (NEB) ...
-
bioRxiv - Biophysics 2023Quote: ... Plasmid DNA for expressing CRY2olig tagged with mCherry at its C-terminus was obtained from Addgene (#60032; Watertown, MA, USA). The plasmid (1.0 µg/dish ...
-
bioRxiv - Genomics 2023Quote: ... The W3 terminator was cloned from Cbh_v5 AAV-saCBE C-terminal (a gift from David Liu, Addgene plasmid #137183, RRID:Addgene_137183)22 and inserted at the EcoRI-XhoI multiple cloning site by Gibson assembly ...
-
bioRxiv - Biochemistry 2023Quote: Restriction-free cloning 30 was used to generate the constructs of MglA-link-MglB with C-terminal hexahistidine tag in pHis17-KanR (mglA-link-mglB-H6, refer Addgene plasmid #78201 for vector backbone ...
-
bioRxiv - Bioengineering 2023Quote: The pSECRETS-C plasmids containing desired on-target sequences were constructed via HiFi assembly into the p11.LacY.wtx1 plasmid (Addgene #69056), which was double digested with XbaI and SphI ...