Labshake search
Citations for Addgene :
251 - 300 of 3045 citations for 6 Bromo N tert butyl 2 4 chlorophenyl imidazo 1 2 a pyridin 3 amine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... Sequences (shPROX1-1: TGCTGTTGACAGTGAGCGCGAGGACCAAGATGTCATCTCATAGTGAAGCCACAGATGTATGAGATGAC ATCTTGGTCCTCATGCCTACTGCCTCGGA; shPROX1-2: TGCTGTTGACAGTGAGCGCCCCCGAGAAAGTTAC AGAGAATAGTGAAGCCACAGATGTATTCTCTGTAACTTTCTCGGGGATGCCTACTGCCTCGGA) were cloned into the LT3GEPIR backbone100 (Addgene; 111177) and used to generate lentiviral particles to transduce into organoids as described99 ...
-
bioRxiv - Plant Biology 2023Quote: ... fw2.2-sgRNA-1 and fw2.2-sgRNA-2 were fused to the Arabidopsis AtU6-26 promoter (Addgene #46968) by digestion-ligation reaction in plCH47751 (Addgene #48002 ...
-
bioRxiv - Neuroscience 2023Quote: We used AAV1-hSyn-GCaMP6f (2 × 1013 vg/mL Penn Vector Core/Addgene; diluted 1:8 to 1:15 in saline) for experiments involving two-photon calcium imaging of V1 layer 2/3 cells ...
-
bioRxiv - Neuroscience 2024Quote: ... Pups were injected unilaterally with 1 μl of AAV9-hSyn-DIO-ChrimsonR-mRuby2-ST (2 × 1012 gc ml−1; Addgene #105448) or 1 μl of AAV9-CAG-Flex-ArchT (2 × 1012 gc ml−1 ...
-
bioRxiv - Cancer Biology 2020Quote: WM266-4 or SK-MEL-2 cells were co-transduced with conditioned media containing lentiviruses bearing Firefly luciferase-7TFP (Addgene #24308, β-catenin reporter) and Renilla luciferase pLenti.PGK.blast-Renilla Luciferase (Addgene #74444 ...
-
bioRxiv - Cell Biology 2021Quote: Stock of lentiviral particles were obtained by transfection of HEK293T cells (2×106 cells) with 2 μg of lentivector plasmid lentiCRISPRv2 (a gift from Feng Zhang, Addgene plasmid, 52961) expressing single guide RNA targeting an exon within ATG5 gene ...
-
bioRxiv - Immunology 2020Quote: ... pTwist EF1 Alpha-SARS-Cov-2-S-2xStrep plasmid encoding for the SARS-CoV-2 Spike protein was a gift from Nevan Krogan (Addgene plasmid #141382). pcDNA3-sACE2(WT)-Fc(IgG1 ...
-
bioRxiv - Bioengineering 2022Quote: ... we generated 2 sgRNA plasmids each harboring 2 distinct sgRNAs targeting the promoter regions of eve (AAEL007369, OA-1053A, Addgene plasmid #184006) and hh (AAEL006708 ...
-
bioRxiv - Neuroscience 2023Quote: ... were secured in a stereotaxic frame and unilateral or bilateral injections of fluorogold or choleratoxin B subunit tracers dissolved in glycerol (FG 2% iontophoresis by 2 µA pulses with 2/2 s on/off duty cycle for 5 minutes and CTB 0.5% iontophoresis by 5 µA pulses with 2/2 s on/off duty cycle for 7-10 minutes) or retrograde pAAVrg-CAG-GFP (Addgene: 37825-AAVrg) or retrograde AAVrg-EF1a-mCherry-IRES-Flpo (Addgene ...
-
Safe plant Hsp90 adjuvants elicit an effective immune response against SARS-CoV2 derived RBD antigenbioRxiv - Molecular Biology 2023Quote: ... pseudo-type lentiviruses coated with the SARS-CoV-2 S protein harboring the vector pCMV14-3X-Flag-SARS-CoV-2 S (a gift from Zhaohui Qian (Addgene plasmid #145780) were prepared by co-transfecting HEK293T cells with psPAX2 (a gift from Didier Trono (Addgene plasmid # 12260 ...
-
bioRxiv - Genomics 2023Quote: ... 16 ug of plasmid were prepared for each plate at a ratio of 4:3:1 (sgRNA library: psPAX2(Addgene ID 12259): pMD2G(Addgene ID 12260)) ...
-
bioRxiv - Cell Biology 2020Quote: ... GFP-C1(2)δ (Tobias Meyer, Addgene plasmid #21216), GFP-nes-2xPABP (Sergio Grinstein ...
-
bioRxiv - Biochemistry 2022Quote: ... pBBR1MCS-2 was a gift from Kenneth Peterson (Addgene plasmid # 85168 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and SARS-CoV-2-S variant (pCDNA 3.1_Spike_Del19, Addgene) at a ratio of 1:2:1 using the transfection reagent (Lipofectamine 3000 ...
-
bioRxiv - Biophysics 2019Quote: ... mCherry-Peroxisomes-2 (peroxisome lumen marker, Addgene plasmid #54520) were gifts from Michael Davidson ...
-
bioRxiv - Immunology 2021Quote: ... 2) luciferase reporter plasmid pLenti-CMV Puro-Luc (Addgene), and 3 ...
-
bioRxiv - Bioengineering 2021Quote: pcDNA3-SARS-CoV-2-S-RBD-sfGFP (Addgene #141184) and pcDNA3-R4-uAb (Addgene #101800 ...
-
bioRxiv - Biochemistry 2020Quote: ... overnight cultures of Rosetta 2 (DE3)/pMSP1D1 (Addgene #20061) were diluted 1:100 in LB (Difco ...
-
bioRxiv - Developmental Biology 2020Quote: ... and 2.5 ng/µl Pmyo-2::mCherry (Addgene #19327). Three injected animals were pooled and incubated for 3 days at 20 °C before adding 250 ng/µl of hygromycin per plate ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV 2/5 hSyn-GCaMP6f was purchased from Addgene (Cat # 100837-AAV ...
-
bioRxiv - Microbiology 2021Quote: ... pBMTL-2 was a gift from Ryan Gill (Addgene plasmid # 22812 ...
-
bioRxiv - Bioengineering 2021Quote: ... (2) chloramphenicol resistance cassette from pTARA[52] (Addgene #39491), (3 ...
-
bioRxiv - Bioengineering 2021Quote: ... (2) chloramphenicol resistance cassette from pTARA[52] (Addgene #39491), (3 ...
-
bioRxiv - Cancer Biology 2020Quote: ... pMDG.2 (a gift from Didier Trono, Addgene #12559) and the lentiviral expression construct ...
-
bioRxiv - Genetics 2020Quote: ... and 2 µg of pMD2.G (Addgene, Cat# 12259)—using Lipofectamine (ThermoFisher ...
-
bioRxiv - Bioengineering 2021Quote: ... (2) araC and PBAD from pTARA[52] (Addgene #39491), (3 ...
-
bioRxiv - Cancer Biology 2022Quote: ... pMDG.2 (VSV-G expressor) and lentiCRISPRv2 (Addgene #52961) for generation of bulk PD-L2-KO cells or luciferase (Addgene #105621 ...
-
bioRxiv - Microbiology 2022Quote: ... individual proteins were cloned into vector 2-BT (Addgene #29666 ...
-
bioRxiv - Synthetic Biology 2022Quote: pcDNA3-SARS-CoV-2-S-RBD-sfGFP (Addgene #141184) and pcDNA3-R4-uAb (Addgene #101800 ...
-
bioRxiv - Pathology 2022Quote: ... pTwist-EF1alpha-SARS-CoV-2-S-2xStrep (Addgene #141382)28 was used ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μg of pMtnA FLAG-IntS6 puro (Addgene #195076) or pMtnA FLAG-IntS12 puro (Addgene #195077 ...
-
bioRxiv - Neuroscience 2022Quote: ... 2) AAV1.CAG.tdTomato (5.06×1012 GC/kg; Addgene #59462), 3 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAVDJ-ef1a-fDIO-EYFP (Addgene 55641, titer 2×1011), AAVDJ-Ef1a-mCherry-IRES-cre (Addgene 55632 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 2 μg of pCMV6M-Pak1-WT (Addgene, 12209), pCMV6M-Pak1-T423E (Addgene ...
-
bioRxiv - Biophysics 2023Quote: ... was expressed in E.coli using a gene with an N-terminal 6×His-tag and an upstream TEV-protease site cloned into pET28a(+) (Addgene plasmid #20061). MSP1D1 was purified using IMAC with further cleavage of 6×His-tag by TEV protease 50,51 ...
-
bioRxiv - Immunology 2020Quote: ... the lentiCas9-v2 lentivirus were produced from HEK-293FT cells transfected with the lentiCas9-v2 plasmid mixed at a 2:1:1 DNA ratio of the lentiviral packaging plasmids pMD2.G (Addgene plasmid #12259) and psPAX2 (Addgene plasmid #12260 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Topbp1 (shTopbp1 #1 and shTopbp1 #2) and a scramble control sequence (shScbl) were cloned into the pLKO.1-Hygro lentiviral vector (Addgene plasmid #24150). The lentiviral-containing medium was harvested from HEK293T cells at 48 h and 72 h after transfection ...
-
bioRxiv - Neuroscience 2020Quote: ... each given at a total volume of 0.8 μl per hemisphere: 1) inhibitory Gi DREADD (AAV5-hSyn-hM4Di-mCherry; UNC Vector Core; n = 5; AAV8-hSyn-hM4Di-mCherry; Addgene; n = 5); excitatory Gq DREADD (AAV8-hSyn-hM3Gq-mCherry ...
-
bioRxiv - Microbiology 2021Quote: ... N (Addgene # 64087), P (Addgene # 64088) ...
-
bioRxiv - Cell Biology 2022Quote: ... CRISPR vector pX330A-1×2 was a gift from Takashi Yamamoto (Addgene plasmid # 58766 ; http://n2t.net/addgene:58766 ; RRID:Addgene_58766) (101) ...
-
bioRxiv - Neuroscience 2020Quote: ... from pBS-KS-attB2-SA(0/1/2)-T2A-LexA::QFAD-Hsp70 plasmids (Addgene #62947, #62948 and #62949) (Diao et al. ...
-
bioRxiv - Neuroscience 2021Quote: AAV1/2.hSyn-GFP particles were generated by co-transfection of HEK293T cells with AAV2/1 (Addgene 112862), AAV2/2 (Addgene 104963) ...
-
bioRxiv - Cell Biology 2020Quote: ... dlg-1::mCherry and ebp-2::egfp vectors were cloned using Gibson assembly and vector pJJR82 (Addgene #75027) (Gibson et al. ...
-
bioRxiv - Biochemistry 2023Quote: ... The SARS-CoV-2 Spike ectodomain Hexa-pro construction (Table 1) was a gift from Jason McLellan (Addgene # 154754 ...
-
bioRxiv - Neuroscience 2022Quote: ... +0.4 ML with diluted (1:3; Addgene) 4 × 0.15 μL of AAV9-Synapsin-jGCaMP7f-WPRE (Addgene) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Reverse: 5’-AAAC-(N)19-20-3’) were designed and cloned in a zebrafish U6 promoter-driven vector (Addgene#64245) at BsmBI restriction sites according to the previous study (Jao et al. ...
-
bioRxiv - Neuroscience 2023Quote: Ntsr1-Cre mice (n = 3) were stereotaxically injected with an inhibitory opsin (AAV1-hSyn-SIO- stGtACR2-FusionRed, 5 x 1011 vg/ml, Addgene) see “Virus injection and optical fiber implantation” 6 weeks prior to the recordings ...
-
bioRxiv - Neuroscience 2024Quote: ... Either AAV-CAG-FLEXFRT-ChR2(H134R)-mCherry (n = 7, 200 nL, 3 × 1012 GC/mL, Serotype: 9; Addgene, MA, USA) to express channelrhodopsin (ChR2 ...
-
bioRxiv - Neuroscience 2020Quote: ... Sham animals included virgins injected with halorhodopsin (AAV1.CaMKIIa.eNpHR.EYFP; Addgene; N=1) that received no optical stimulation ...
-
bioRxiv - Neuroscience 2022Quote: ... Most CaMKII mice (n=4) were infused with AAV9-CaMKII-SomArchon-GFP (titer: 3.2×1012 GC/mL, Addgene #126942), and one CaMKII mouse was infused with AAV9-synapsin-SomArchon-GFP (titer ...