Labshake search
Citations for Addgene :
251 - 300 of 2960 citations for 6 9 Methano 4 1 benzoxazepin 2 3H one octahydro 3 methyl 3 α 5a bta 6 bta 9 bta 9a bta 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... The wild-type 14-3-3 ζ gene was cloned into NcoI/XhoI digested pBAD plasmid (Addgene #85482) with a TEV cleavable C-terminal His6 purification tag ...
-
bioRxiv - Molecular Biology 2023Quote: gRNAs targeting LSM14A (5’-TCTGTACCAAAGGATCGAAC-3’) and XRN1 (5’-AGAGAAGAAGTTCGATTTGG-3’) were cloned into LentiCRISPR v2 (Addgene #52961) using BsmBI restriction enzyme sites and confirmed by sequencing ...
-
bioRxiv - Bioengineering 2024Quote: ... Double-cysteine substitution variants of DoubleCatcher were derived from pDEST14-SpyCatcher003-(GSG)3-SpyCatcher003-TEVs-SpyTag003DA by Gibson assembly: DoubleCatcher α-Lock (GenBank and Addgene deposition in progress), DoubleCatcher β-Lock (GenBank and Addgene deposition in progress) ...
-
bioRxiv - Genomics 2020Quote: ... pCFJ104 - Pmyo-3∷mCherry∷unc-54 (Addgene plasmid # 19328 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 3 μg psPAX2 (packaging plasmid; Addgene) was performed using iN-fect (Intron Biotechnology ...
-
bioRxiv - Cell Biology 2021Quote: ... and pGH8 (Prab-3::mCherry, Addgene #19359) (Frøkjaer-Jensen et al. ...
-
bioRxiv - Genomics 2022Quote: ... and 3 μg pMD2.G (Addgene, #12259) into 293T cells cultured in 100 mm dish ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 μg of pGW-PervevalHR (Addgene #57432) (22) ...
-
bioRxiv - Immunology 2021Quote: ... myc (pCSF107mT-GATEWAY-3’-Myc tag, Addgene), green fluorescence protein (GFP ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 3 μg of pVSVg (8454; Addgene); FuGENE HD transfection reagent (Promega ...
-
bioRxiv - Genetics 2022Quote: ... Tc’hsp5’-Gal4Delta-3’UTR] (Addgene plasmid # 86449) was used as a donor plasmid with Piggybac insertion repeats and the 3xP3::EGFP reporter (Schinko et al. ...
-
bioRxiv - Physiology 2023Quote: ... and mPlum-mito-3 (Addgene plasmid #55988) using Fugene6 (Promega Inc. ...
-
bioRxiv - Synthetic Biology 2022Quote: ... MAFA in pX330S-3 (Plasmid #58779, Addgene), Insulin in pX330S-4 (Plasmid #58780 ...
-
bioRxiv - Genomics 2023Quote: ... with 3 μg of psPAX (Addgene, 12260) and 1 μg of pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2021Quote: ... For generation of KO cell line pools PC-9 and HCC827 cells were transduced with pKLV2-EF1a-Cas9Bsd-W (Addgene ID:68343)[71] to stably express Cas9 ...
-
bioRxiv - Cell Biology 2022Quote: ... 6 μg of psPAX2 packaging plasmid (plasmid #12260; Addgene, Teddington, UK), 2 μg pMD2.G envelope plasmid (plasmid #12259 ...
-
bioRxiv - Bioengineering 2023Quote: ... we followed the protocol of our previous study20 to transfected 6 individually isolated fibroblast lines with 4 μg of episomal plasmid (#58527; Addgene, Watertown, MA, USA) using the NucleofectorTM II with the A-024 program (Amaxa ...
-
bioRxiv - Developmental Biology 2019Quote: The GLI-3 bs-2 plasmid carrying the human GLI3 (Kinzler et al., 1988) was purchased from Addgene. F387F*fs mutation was generated in the vector pCDNA3 hGli3 using Q5 site directed mutagenesis kit (NEB ...
-
bioRxiv - Neuroscience 2021Quote: ... The visual cortex was injected with a total of 2–3 μl of virus solution (1e13 GC/ml) containing AAV9-Syn-GCaMP6s.WPRE.SV40 (Penn Vector Core or Addgene) through a beveled glass micropipette (tip size 10–20 μm diameter ...
-
bioRxiv - Cancer Biology 2022Quote: ... sgRNA#2: 5’-aacctgagtgatatgactag-3’) were cloned into a modified version of the lentiCRISPR v2 backbone (RRID: Addgene_52961) in which a puromycin resistance ORF was cloned under the hPGK promoter ...
-
bioRxiv - Microbiology 2023Quote: ... ATG16L1 shRNA (5’-GTCATCGACCTCCGGACAAAT-3’) was inserted into pLKO.1 puro (Addgene plasmid #8453) to generate pLKO.1-ATG16L1-shRNA ...
-
bioRxiv - Cancer Biology 2023Quote: ... sh2: 5-CCAACAACATCTTCTGCTCC-3’ were cloned into the lentiviral vector pLKO.1 (Addgene #8453)[16] ...
-
bioRxiv - Genomics 2022Quote: ... gRNAs were constructed from pSLQ2853-3 pHR: U6-Sasgv2CXCR4-1 CMV-EGFP (Addgene 84254) and pSLQ1852-2 pHR ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.75 µL of rgAAV-FLEX-tdTomato (diluted 1:3 in dPBS; Addgene number: 28306) was injected in TH-Cre mice in basal forebrain (AP ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2μg of target shRNA construct and 2μg of 3:1 ratio of psPAX2 (Addgene) and pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: ... HEK293T cells were seeded at 80% density in a 10-cm tissue cell culture treated dish and transfected with the 6 µg of expression plasmid and packaging plasmids 2 µg of pMD2.G (Addgene, cat# 12259) and 4 µg of psPAX2 (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were plated in 6-well plate and co-transfected with SBE4-Luc plasmid (1 μg, Addgene,16495) and pDEST26-Renilla plasmid (0.1 μg ...
-
bioRxiv - Cell Biology 2020Quote: ... 25 ng/µl of co-injection marker pCFJ104 (Pmyo-3:mCherry:unc-54 3’UTR, a gift from Erik Jorgensen, Addgene plasmid #19328 ...
-
bioRxiv - Neuroscience 2022Quote: ... The cDNA of Ncam2.1 was amplified from the pCNcam2.1 with 5’-ACCATGAGCCTCCTCCTCTCC-3’ and 5’-CTGACCAAGGTGCTGAAACT-3’and cloned into pWPI (Plasmid #12254, Addgene) within PmeI site to obtain the pWPI-NCAM2.1 ...
-
bioRxiv - Neuroscience 2022Quote: ... The cDNA of Ncam2.2 was amplified with 5’-ACCATGAGCCTCCTCCTCTCC-3’ and 5’-TCTCTGATCAGGGAGTACCA-3’ and cloned into pWPI (Plasmid #12254, Addgene) within PmeI site to obtain the pWPI-NCAM2.2.
-
bioRxiv - Neuroscience 2022Quote: ... A pcDNA3 flag HA 14-3-3 β plasmid was a gift from William Sellers (Addgene plasmid # 8999; http://n2t.net/addgene:8999; RRID:Addgene_8999). All plasmids were verified by Sanger sequencing and/or long-read sequencing (Iowa IIHG Genomics core or Plasmidsaurus ...
-
bioRxiv - Systems Biology 2019Quote: ... A20-targeting guide RNAs (5’ – CACCGTTTGCTACGACACTCGGAAC – 3’, and 5’ – CACCGCTCGGAACTTTAAATTCCGC – 3’) were cloned into lentiCRISPR v2 (Addgene Plasmid #52961)48 and used for lentivirus production in HEK293T cells ...
-
bioRxiv - Genetics 2023Quote: ... GFP-3’UTR was PCR amplified using primers (5’-AGCTTGCATGCCTGCAGGTCG-3’ and 5’-AAGGGCCCGTACGGCCGACTA-3’) and plasmid pPD95.75 (Plasmid #1494-Addgene) as the template ...
-
bioRxiv - Molecular Biology 2024Quote: ... SK-BR-3 HER2-knockout (SK-BR-3 KO) were obtained using pSpCas9 BB-2A-Puro (PX459) V2.0 (9200 bp, Addgene) containing a sgRNA sequence (5’-TCATCGCTCACAACCAAGTG-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... a single guide RNA (sgRNA) targeting exon 4 of TP53 (5’-CTGTCATCTTCTGTCCCTTC-3’) was cloned into pSpCas9(BB)-2A-GFP (pX458, plasmid #48138, Addgene). pSpCas9(BB)-2A-GFP was a kind gift from dr ...
-
bioRxiv - Cell Biology 2023Quote: ... The RAD52KO cell line was generated from the RAD52WT line by CRISPR-Cas9-mediated deletion of the 1.1kb region between exons 3 and 4 using guide RNAs sg1 and sg2 cloned into px330 (Addgene #42230) as previously described (Kelso et al ...
-
bioRxiv - Developmental Biology 2021Quote: ... The following guides 5’-GGACCTGTTCGGAATCCACC-3’ and 5’-GGGTGAGGTTCTGTCTACCC-3 were separately cloned into the BbsI site of pU6-BbsI-chiRNA plasmid (obtained from Addgene) and both were simultaneously injected by Best Gene into w1118 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and for the downstream guide PUS1dnF 5’-CACCGATAACAGCGGTTAGCGGCA -3’ and PUS1dnR 5’-AAACTGCCGCTAACCGCTGTTATC -3’ were phosphorylated and annealed and then cloned into px458 (Addgene) digested with BbsI ...
-
bioRxiv - Cell Biology 2020Quote: ... guide RNA (gRNA) targeting TMEM41A (5’-GCCGAGAAGCGGGCGCATGT-3’) and TMEM64 (5’-CCGCGCTGGGCCGAGGCATG-3’) were cloned into pSpCas9(BB)-2A-GFP (Addgene #48138 ...
-
bioRxiv - Neuroscience 2020Quote: ... The entire coding sequence of GCaMP6s was amplified by PCR with primers 5’–GGATCCGCCACCATGGGTTCTCATCATCATCA–3’ and 5’–GTAGCCGAACCGGTCTTCGCTGTCATCATTTGTAC–3’ using pGP-CMV-GCaMP6s (Addgene plasmid # 40753 ...
-
bioRxiv - Neuroscience 2022Quote: ... we generated two independent sgRNA lines that targeted the first and sixth exons (sgRNA1: 5’ GGTGTCTTCATTGGCGCCGCTGG 3’; sgRNA2: 5’ CATTGATGGATTCTACTCCCGGG 3’) and cloned each into the pU63 vector (#49410; Addgene). Constructs were sent to BestGene Inc ...
-
bioRxiv - Cell Biology 2022Quote: ... sgRNA for human ATP6V0C (5’-GAATAGTCGGGGCTGCTGGG-3’) and ATP6V0D1 (5’-TCGATGACTGACACCGTCAG-3’) were cloned to lentiCRISPR v2 plasmid (Plasmid #52961, Addgene), followed by virus package and infection procedures as described previously69 ...
-
bioRxiv - Molecular Biology 2022Quote: SUGP1 constructs were cloned from pHA-SUGP1 using primers (IB0156 5’-atgacgtcccagactacgcagctagcAGTCTCAAGATGGACAACC-3’; IB0157 5’-tgtttagcgttcagcagcgggatagatccgcctgaGTAGTAAGGCCGTCTGG-3’) into pCDNA3_3xHA-miniTurbo-NLS (Addgene #107172) digested with NheI-HF (NEB #R3131).
-
bioRxiv - Developmental Biology 2023Quote: ... The oligos (5-taggCCTGACAGTACTCACGAC -3’ and 5’-aaacGTCGTGAGTACTGTCAGG -3’) were annealed and ligated into the pT7-gRNA vector (Addgene #46759)(74 ...
-
bioRxiv - Physiology 2023Quote: ... abcc9 gRNA (5’ CATTGCCACGAAGCTGGCGG 3’) or kcnj8 gRNA (5’ ACGCCACTTCAGGTCTACCA 3’) were cloned into BbsI digested plasmid pX330 (Addgene # 42230). T7 sgRNA template and T7 Cas9 template were prepared by PCR amplification and gel purification ...
-
bioRxiv - Microbiology 2023Quote: ... Truncation mutations in NL4-3 were created by subcloning the region of NL4-3 between EcoRI to XhoI into pBlueScript KS(-) (Addgene), followed by site-directed mutagenesis to introduce a stop codon to generate the desired truncation mutation ...
-
bioRxiv - Cell Biology 2023Quote: ... two sequences targeting exon 1 of Numb (5’-GAAAGACGTTTATGTCCCAG-3’ and 5’-GGAAGCTACACTTTCCAGTG-3’) were individually cloned into plasmid pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene #62988). These guide constructs were then electroporated into mESCs using the Lonza Nucleofector 2b Device and Cell Nucleofector Kit (Lonza #VAPH-1001) ...
-
bioRxiv - Immunology 2024Quote: ... targeting CYLD was cloned by annealing two DNA oligos (forward, 5’-GTGGTCAAGGTTTCACTGAC-3’; reverse, 5’-GTCAGTGAAACCTTGACCAC-3’) and ligating into lentiCRISPER v2 (52961, Addgene) plasmids ...
-
bioRxiv - Cell Biology 2024Quote: ... the primers 5’-CACCGCATCGCTCCTGCGTCCGCCA-3’ and 5’-AAACTGGCGGACGCAGGAGCGATGC-3’ were annealed and subcloned into px458-pSpCas9(BB)-2A-GFP (Addgene) using the BpiI restriction site to generate a guide RNA ...
-
bioRxiv - Neuroscience 2021Quote: ... and sg-KCTD16-2 (5’-TTCCGCAAACCAAAATCCGG-3’) were then cloned into the AAV-U6-sgRNA-hSyn- mCherry plasmid (RRID:Addgene_87916) using the SapI site 5’ of the gRNA scaffold ...