Labshake search
Citations for Addgene :
251 - 300 of 3495 citations for 6 9 Ethano 4H imidazo 4 5 d pyridazino 1 2 a pyridazin 4 one 2 butyl 3 6 7 8 9 11 hexahydro 6 9 dimethyl 3 2' 2H tetrazol 5 yl 1 1' biphenyl 4 yl methyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Zero-shot learning enables instant denoising and super-resolution in optical fluorescence microscopybioRxiv - Bioengineering 2023Quote: ... and the sgRNA was ligated into pX330A-1×2 (Addgene, 58766). To construct donor vector ...
-
bioRxiv - Genomics 2022Quote: ... and pSLQ1852-2 pHR: U6-SpsgCD95-1 CMV-EGFP (Addgene 84151) with slight modifications ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were plated in 6-well plate and co-transfected with SBE4-Luc plasmid (1 μg, Addgene,16495) and pDEST26-Renilla plasmid (0.1 μg ...
-
bioRxiv - Neuroscience 2021Quote: ... with sgRNA (5’-CTTGTGGGGTCA-TGGTTTACAGG-3’) plasmid (Addgene, 68463), Cas9 plasmid ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV9-hSyn- GrabDA1h (n = 5 Area X hemispheres; n = 2 MST hemispheres; Addgene), AAV5-CAG- Dlight1.1 (n = 1 Area X hemisphere ...
-
bioRxiv - Immunology 2019Quote: ... and 6-His tag (Addgene plasmid# 50803) [36] ...
-
bioRxiv - Cell Biology 2020Quote: 6×His-tagged VHH-mCherry (Addgene #109421) was transformed into BL21DE3 E.coli cells ...
-
bioRxiv - Genomics 2021Quote: ... and pMD2.G (Addgene, 12259, 6 µg) using calcium phosphate precipitation (62) ...
-
bioRxiv - Neuroscience 2019Quote: ... 6 μg pSAD-∆G-F3 (Addgene, 32634) with different fluorescent protein genes and helper plasmids (3 μg pcDNA-SADB19N (Addgene ...
-
bioRxiv - Pathology 2021Quote: ... and 6 μg pMD2.G (Addgene 12259) or pEC120-S-D19-V5 ...
-
bioRxiv - Plant Biology 2023Quote: ... All four Level 1 cassettes were assembled in a one-step reaction into the Level 2 acceptor plasmid (pAGM4723 Addgene #48015) as previously described (Dudley et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... gonads of young adult BOX428 animals were microinjected with 30 ng/μl Pelt-2::αGFP-NB::ZIF-1 and 2.5 ng/μl Pmyo-2::GFP (#Addgene 26347) as a co-injection marker ...
-
bioRxiv - Cancer Biology 2023Quote: ... shRNA 2 (shYAP1 #2) or scramble shRNA (shNC) were inserted into pLKO.1-TRC Cloning Vector (Addgene, 10878, RRID: Addgene_10878) following the manufacturer’s protocol and sequenced ...
-
bioRxiv - Cancer Biology 2023Quote: ... shRNA 2 (shYAP1 #2) or scramble shRNA (shNC) were inserted into pLKO.1-TRC Cloning Vector (Addgene, 10878, RRID: Addgene_10878) following the manufacturer’s protocol and sequenced ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... encoding the Luc mRNA with the SARS-CoV-2 packaging signal in 3’-UTR (Addgene), were co-transfected with plasmids expressing the SARS-CoV-2 nucleocapsid (nCoV-2-N) ...
-
bioRxiv - Genomics 2020Quote: ... a total of 4 guides flanking the region to be deleted (2 on each side) were cloned into the pX459-v2 vector (Addgene #62988) (Ran et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... cells were transfected with 4 μg of corresponding transfer plasmid and 2 μg each of the four helper plasmids: pMDLg/pRRE (Addgene, #12251), pRSV/REV (Addgene ...
-
bioRxiv - Microbiology 2020Quote: ... 9 µg of psPAX2 (a gift from Didier Trono (Addgene plasmid # 12260 ; http://n2t.net/addgene:12260; RRID:Addgene_12260), and 3 µg of pCAGGS-S (SARS-CoV-2)(Catalog No ...
-
bioRxiv - Synthetic Biology 2024Quote: ... the two fragments of FlipGFP B1-9 and B10-E5-B11-TEVcs-K5 were amplified from Addgene Plasmid #124429 via PCR ...
-
bioRxiv - Microbiology 2023Quote: 4e5 VeroE6 cells were plated in 6-well plates and transfected with 1 μg VSV-G plasmid (Addgene #8454) via TransIT-X2 (Mirus) ...
-
bioRxiv - Cell Biology 2023Quote: ... we cloned human OPTN cDNA in a pETDuet-1 vector with an N-terminal 6×His tag followed by a TEV cleavage site (RRID:Addgene_190191). After the transformation of the pETDuet-1 vector encoding 6×His-TEV-mCherry-OPTN in E ...
-
bioRxiv - Cell Biology 2023Quote: ... we cloned human NDP52 cDNA in a pETDuet-1 vector with an N-terminal 6×His tag followed by a TEV cleavage site (RRID:Addgene_187829). After the transformation of the pETDuet-1 vector encoding 6×His-TEV-mCherry-NDP52 in E ...
-
bioRxiv - Neuroscience 2020Quote: ... In one C57BL/6 animal each we used AAV5-Syn-GCaMP6s or AAVrg-Syn-jGCaMP7f (Addgene, USA) with similar results to those obtained with GCaMP6f (Supplementary Fig ...
-
bioRxiv - Synthetic Biology 2022Quote: ... benthamiana U6 promoter (NbU6-1 Addgene#185623 and NbU6-2 Addgene#185624) (Supplementary Table S6) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... benthamiana U6 promoter (NbU6-1 Addgene#185623 and NbU6-2 Addgene#185624) (Supplementary Table S6) ...
-
bioRxiv - Cell Biology 2022Quote: ... CRISPR vector pX330A-1×2 was a gift from Takashi Yamamoto (Addgene plasmid # 58766 ...
-
bioRxiv - Neuroscience 2023Quote: Burrhole injections of viral constructs [rAAV2/1&2.hSyn.SIO-eOPN3-mScarlet (Addgene 125713 diluted to 6 × 1012 viral genomes/mL ...
-
bioRxiv - Neuroscience 2023Quote: ... doublefloxed.hChR2(H134R).EYFP.WPRE-HGHpA (diluted 1:2 with dPBS; Addgene number: 20298) was injected into auditory cortex as described above in ChAT-Cre animals ...
-
bioRxiv - Cancer Biology 2023Quote: ... AAACTCGGAGTTCTCAGAGCCCAGC NFKB2 guide #1 F: CACCGTGGCCCCTACCTGGTGATCG NFKB2 guide #1 R: AAACCGATCACCAGGTAGGGGCCAC NFKB2 guide #2 F: CACCGCTTTCGGCCCTTCTCACTGG NFKB2 guide #2 R: AAACCCAGTGAGAAGGGCCGAAAGC pLKO.TRC (Addgene; Cat#10878) was used for generating shNMNAT1 KD in U-87 MG and U-251 MG cell lines ...
-
bioRxiv - Neuroscience 2023Quote: Th-cre rats were randomly assigned to a viral group and infused bilaterally with a cre-dependent AAV encoding either the inhibitory opsin archaerhodopsin T (ArchT; N = 11; 6 males; AAV5-CAG-FLEX-ArchT-tdTomato, Addgene) or a tdTomato fluorescent protein control (tdTomato ...
-
bioRxiv - Cancer Biology 2023Quote: ... and TGFBR2 (5’-ccttgtagacctcggcgaag-3’) cloned into LentiCRISPRv2 puro (Addgene) (20) ...
-
bioRxiv - Developmental Biology 2023Quote: Transgenic animals were generated by injecting transgenes (15 ng μl-1 each) mixed with a co-injection marker pRF-4 (120 ng μl-1) (Addgene) expressing a dominant negative variant of the rol-6 gene and an empty vector pSK (up to 200 ng μl-1 of DNA ...
-
bioRxiv - Cell Biology 2019Quote: ... containing the FOXJ1 targeting sgRNA sequence 5’-GGGCCTTCTTGTAAGAGGCC-3’ or the CCDC40 targeting sgRNA sequence 5’-CTCCTCGTTGGCGGCTGCGCAGG-3’ with 1 μg of MBX plasmid (gift from Linzhao Cheng, Addgene plasmid #64122) and 1 μg of homemade donor plasmid pUC19_FOXJ1_mCherry_cNEO for the FOXJ1_mCherry tagging project were mixed with 4 μL of Lipofectamine and left at room temperature for 10 min to form complexes ...
-
bioRxiv - Cancer Biology 2020Quote: ... The HK2-targeting sequence 5’-CCGGCCAGAAGACATTAGAGCATCTCTCGAGAGATGCTCTAATGTCTTCTGGTTTTTT-3’ was cloned in the pLKO.1 hygro vector (a gift from Bob Weinberg; Addgene plasmid #24150). HK2 expression in Huh7-GCK+/HK2+ and Huh7-GCK+/HK2−Sh was analyzed on cell lysates by western blotting (Supplementary Fig ...
-
bioRxiv - Plant Biology 2024Quote: ... Acceptors were pOdd1-4 (pCk1-4, Addgene plasmids # 136695-136698) for Level 1 and 3 and pEven1-4 (pCsA-E ...
-
bioRxiv - Cell Biology 2020Quote: ... A glass capillary with a fine tip containing plasmid solution is inserted into the eye primordium of stage 26-30 embryos to inject 8−5-8 nl doses of 1 µg/µl of pEGFPC1-hVAP-A (Addgene #104447) or pEGFPC1-hVAP-A KD/MD (Addgene #104449 ...
-
bioRxiv - Developmental Biology 2020Quote: ... targeting the 5’ (5’-AGTGCGCTTCGTCACTGCAC-3’) and 3’ (5’-TCCTCCCGCCCCGACGCGGA-3’) region of the Spen ORF were cloned in the Cas9-GFP pX458 vector (Addgene plasmid #48138). Compatible 5’ and 3’ Homology arms (HA ...
-
bioRxiv - Microbiology 2020Quote: ... 9 µg of pLV-eGFP (a gift from Pantelis Tsoulfas (Addgene plasmid # 36083; http://n2t.net/addgene:36083; RRID:Addgene_36083), 9 µg of psPAX2 (a gift from Didier Trono (Addgene plasmid # 12260 ...
-
bioRxiv - Molecular Biology 2019Quote: ... The single vector mammalian expression system containing a CAG promoter-driven St1Cas9 LMD-9 and its U6-driven sgRNA (U6_sgRNA_CAG_hSt1Cas9_LMD9; Addgene plasmid #110626) was built from the above-described plasmids ...
-
bioRxiv - Cancer Biology 2020Quote: ... H357 and SCC-9 cells were transfected with RRBP1 overexpression plasmids pcDNA4 HisMax-V5-GFP-RRBP1(Addgene:Cat#92150) using the ViaFect transfection reagent (Promega Cat# E4982) ...
-
bioRxiv - Molecular Biology 2019Quote: ... The U6-driven sgRNA expression cassettes for St1Cas9 (LMD-9) (v1, v2, v3) (St1Cas9_LMD-9_sgRNA_pUC19; Addgene plasmid #110627) were synthesized as gBlock gene fragments (Integrated DNA Technologies ...
-
bioRxiv - Neuroscience 2020Quote: ... pAAV-Ef1a-DIO hChR2 (E123T/T159C)-EYFP (gift from Karl Deisseroth, packaged into AAV serotype 9 from Addgene, plasmid # 35509 ...
-
bioRxiv - Microbiology 2022Quote: ... PCDNA3-GFP1-9 T2A mCherry was a gift from Xiaokun Shu (Addgene plasmid # 124430;http://n2t.net/addgene:124430; RRID:Addgene_124430) (PMID ...
-
bioRxiv - Neuroscience 2023Quote: ... We used the following viral constructs and injection volumes per site in the different types of experiments: AAV.9.Syn.Flex.GCaMP6f.WPRE.SV40 (calcium recordings 140 nl; Addgene, no. 100833); AAV.1.hSyn.dio.EGFP (anterograde labelling ...
-
bioRxiv - Immunology 2022Quote: ... RAW 264.7 macrophages were transduced with lentiviral particles containing Gal-9-3xFLAG expressed from pLenti-puro (Addgene #39481). Primary murine bone marrow-derived macrophages (BMMs ...
-
bioRxiv - Cancer Biology 2020Quote: ... to co-transfect pBABE-puro or pBABE-puro.SLX4IP.3xFLAG with pCMV-VSV-G (at a ratio of 6:1, Addgene#8454) into GP2-293 cells (Clontech) ...
-
bioRxiv - Bioengineering 2020Quote: ... 400,000 HEK cells were seeded in 6-well plates and the next day transfected with 1 μg psPAX2 (Addgene #12260), 3 μg pCMV-VSV.G (Addgene ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were transfected with a 6:1 ratio of a firefly luciferase reporter plasmid driven by a pGL3-RARE-responsive promoter (Addgene) and a Renilla luciferase reporter plasmid driven by a constitutive CMV promoter (Promega) ...
-
bioRxiv - Neuroscience 2022Quote: ... 6 mice from each line were injected bilaterally with a pAAV9-CAG-Flex.GCaMP6s.WPRE.SV40 virus (Addgene, titre ≥ 1×1013 vg/mL) in the medial NAc shell (D1-cre and D2(A2a)-cre mice ...
-
bioRxiv - Developmental Biology 2023Quote: ... expressing a dominant negative variant of the rol-6 gene and an empty vector pSK (up to 200 ng μl-1 of DNA) (Addgene) using standard methods (42) ...