Labshake search
Citations for Addgene :
251 - 300 of 333 citations for 6 9 Anthroyloxy stearic acid 6 as since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... 9 µg of psPAX2 (a gift from Didier Trono (Addgene plasmid # 12260 ; http://n2t.net/addgene:12260; RRID:Addgene_12260), and 3 µg of pCAGGS-S (SARS-CoV-2)(Catalog No ...
-
bioRxiv - Neuroscience 2021Quote: ... 8-9 20 nL injections of AAV1-Syn-flex-GCaMP6s (Addgene #100845-AAV1, Chen et al., 2013) were delivered to the RSC (AP ...
-
bioRxiv - Biochemistry 2020Quote: ... and for luciferase assays a ratio of 1:9:10 HA-Clover plasmid:pcDNA(-):HRE-Luciferase (Addgene #26731) was used (physiological expression levels) ...
-
bioRxiv - Neuroscience 2022Quote: ... versus a respective control virus AAV2/1-DIO-hSYN1-mCherry (Addgene # 50459; titer: 9 × 1012 gc/ml). To ablate PVNOT neurons ...
-
bioRxiv - Neuroscience 2024Quote: The plasmid WPRE-ab (pAAV/mIba1.GFP.WPRE.miR-9.T.miR-129-2-3p.T.SV40pA) was obtained from previous studies in our laboratory (Addgene plasmid #190163). The plasmid CAG-eYFP-3x-miR708-5p-TS was a gift from Viviana Gradinaru (Addgene plasmid #117381 ...
-
bioRxiv - Microbiology 2020Quote: ... 9 µg of pLV-eGFP (a gift from Pantelis Tsoulfas (Addgene plasmid # 36083; http://n2t.net/addgene:36083; RRID:Addgene_36083), 9 µg of psPAX2 (a gift from Didier Trono (Addgene plasmid # 12260 ...
-
bioRxiv - Cancer Biology 2020Quote: ... H357 and SCC-9 cells were transfected with RRBP1 overexpression plasmids pcDNA4 HisMax-V5-GFP-RRBP1(Addgene:Cat#92150) using the ViaFect transfection reagent (Promega Cat# E4982) ...
-
bioRxiv - Neuroscience 2020Quote: ... pAAV-Ef1a-DIO hChR2 (E123T/T159C)-EYFP (gift from Karl Deisseroth, packaged into AAV serotype 9 from Addgene, plasmid # 35509 ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK293T cells (between passage 9-11) were transfected with lentiviral packaging vector psPAX2 (#12259, Addgene, Watertown, MA, USA), the envelope vector pMD2.G (#12260 ...
-
bioRxiv - Neuroscience 2022Quote: ... rAAV2/9 encoding jRGECO1a under control of the human synapsin promoter (4 × 1013 gc/ml; customized from AddGene plasmid #61563 ...
-
bioRxiv - Microbiology 2022Quote: ... PCDNA3-GFP1-9 T2A mCherry was a gift from Xiaokun Shu (Addgene plasmid # 124430;http://n2t.net/addgene:124430; RRID:Addgene_124430) (PMID ...
-
bioRxiv - Immunology 2022Quote: shRNAs were designed to target human Galectin-9 mRNA and cloned into the pLKO.1 vector (Addgene #10878). The sense shRNA sequences are CCTGGTGCAGAGCTCAGATTT (shGal-9 #1 ...
-
bioRxiv - Immunology 2022Quote: ... RAW 264.7 macrophages were transduced with lentiviral particles containing Gal-9-3xFLAG expressed from pLenti-puro (Addgene #39481). Primary murine bone marrow-derived macrophages (BMMs ...
-
bioRxiv - Neuroscience 2024Quote: ... We used the following viral constructs and injection volumes per site in the different types of experiments: AAV.9.Syn.Flex.GCaMP6f.WPRE.SV40 (calcium recordings 140 nl; Addgene, no. 100833); AAV.1.hSyn.dio.EGFP (anterograde labelling ...
-
bioRxiv - Neuroscience 2021Quote: ... We bilaterally injected 368 nl of AAV2/9 hSyn.hChR2(H134R).eYFP.WPRE.hGH (UPenn Vector Core) or AAV2/9 CaMKII.ArchT-GFP (UNC Vector Core) or pGP-AAV-syn-jGCaMP7f-WPRE (Addgene) to the LEC or MEC ...
-
bioRxiv - Microbiology 2021Quote: ... the TEV FlipGFP plasmid PCDNA3-FlipGFP(TEV cleavage seq) T2A mCherry (Addgene, #124429, a gift from Xiaokun Shu [9]) was used as a template for pairs of PCR reactions including primers designed to generate overlapping products replacing the TEV cleavage site with the indicated cleavage sequence (S9 Table) ...
-
bioRxiv - Neuroscience 2022Quote: ... we injected either rAAV2/9 encoding GCaMP6s (Chen et al., 2013) under control of the CaMKII promoter (1.25 × 1013 gc/ml; AddGene viral prep #107790-AAV9 ...
-
bioRxiv - Neuroscience 2022Quote: ... or rAAV2/9 encoding for NIR-GECO2 under control of the synthetic CAG promoter (0.5 × 1012 -1 × 1013 gc/ml; AddGene plasmid #159603 ...
-
bioRxiv - Neuroscience 2022Quote: ... PV mice (n=9) were infused with AAV9-CAG-FLEX-SomArchon-GFP (titer: 6.3×1012 – 1.1×1013 GC/mL, Addgene #126943) or AAV9-synapsin-FLEX-SomArchon-GFP (titer ...
-
bioRxiv - Immunology 2024Quote: ... Anti-CD19 scFv amino acid sequence was obtained from Addgene plasmid #79125 ...
-
bioRxiv - Microbiology 2020Quote: ... were plated in a 100-mm tissue culture dish and transfected the next day when they were about 75% confluent with a combination of the following plasmids: 9 µg of pLV-eGFP (a gift from Pantelis Tsoulfas (Addgene plasmid # 36083 ...
-
bioRxiv - Genomics 2022Quote: ... 12 μg of plasmid library was cotransfected with 9 μg psPAX2 and 3 μg pMD2.G (Addgene #12260 and #12259) into HEK293FT cells using 72 μl Lipofectamine 2000 (Life Technologies #11668019) ...
-
bioRxiv - Neuroscience 2021Quote: Cre-dependent adeno-associated virus (AAV; serotypes 5 or 9) was used to express GCaMP6s (AAV5-Syn-Flex-GCaMP6s, Addgene), or GCaMP7f (AAV9-Syn-Flex-jGCaMP7f-WPRE ...
-
bioRxiv - Neuroscience 2020Quote: ... and 0.1 μL of adeno-associated virus serotype 9 (AAV9) carrying GCaMP6f under the excitatory neuronal promoter CaMKII (AAV-CaMKII-GCaMP6f) (Addgene) to co-transfect the TRPV1 and GCaMP6f into neurons.
-
bioRxiv - Neuroscience 2021Quote: Cultured Cdh11 wild-type and knockout hippocampal neurons (300,000 cells/2 cm2) were transfected at 3 DIV or 9 DIV with the pLL3.7-GFP vector (Addgene Cat#11795) using Lipofectamine 2000 (Invitrogen Cat#11668-019 ...
-
bioRxiv - Neuroscience 2023Quote: ... University of Zurich (purified by VVF as v723-9; AAV9-hCMV-HA-SpCas9, Addgene 106431, gift from Juan Belmonte [22]).
-
bioRxiv - Neuroscience 2022Quote: ... AAV9-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA (300 nL; 3×1011 GC/ml; Serotype:9; Addgene, Massachusetts, USA) was unilaterally injected into the right MePD using a 2-μL Hamilton micro syringe (Esslab ...
-
bioRxiv - Neuroscience 2024Quote: ... Either AAV-CAG-FLEXFRT-ChR2(H134R)-mCherry (n = 7, 200 nL, 3 × 1012 GC/mL, Serotype: 9; Addgene, MA, USA) to express channelrhodopsin (ChR2 ...
-
bioRxiv - Neuroscience 2024Quote: ... to express channelrhodopsin (ChR2) or control virus (n = 4, AAV-Ef1a-fDIO-mCherry, 200 mL, 3 × 1012 GC/mL; Serotype: 9; Addgene) was unilaterally injected over 10 minutes into the MePD using a 2-µL Hamilton microsyringe (Esslab ...
-
bioRxiv - Neuroscience 2023Quote: ... and AAV2/9-EF1a-SaCas9-P2A-HA produced from the plasmid pAAV-EFS-SaCas9-P2A-HAFLAGHA-KASH-pA (Addgene #113688) (46) ...
-
bioRxiv - Plant Biology 2024Quote: ... the constructs encoding S10-tagged and S11-tagged protein fusions were co-expressed in the presence of UBQ10:sXVE: GFP1–9 (Addgene plasmid # 108187 ...
-
bioRxiv - Neuroscience 2020Quote: Raphe and RTN neurons - AAV-9: pGP-AAV-syn-GCaMP6s-WPRE.4.641 at a titre of 1×1013 GC·ml- 1 (Addgene, Watertown, MA, USA);
-
Targeting Noradrenergic Neurons of the Locus Coeruleus: A Comparison of Model Systems and StrategiesbioRxiv - Neuroscience 2022Quote: ... Injections of rAAV2/9-Ef1a-DO-DIO-tdTomato-eGFP (2.3 × 1013 gc/ml; kindly gifted from Bernardo Sabatini; AddGene plasmid #37120)34 were performed in TH- and DBH-cre animals to estimate the viral spread ...
-
bioRxiv - Biophysics 2022Quote: ... The following expression vectors were used for plasmid DNA transfections: pCMV-mEmerald-FilaminA-N-9 (Addgene #54098, gift from Michael Davidson), pCMV-mCherry-FilaminA-N-9 (Addgene #55047 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... L2 assembly: L1 modules and annealed oligonucleotides (8-9, Table S5) assembled into the L2 destination vector pAGM4723-Del (Addgene #112207). The final plasmids ...
-
Nonsense Mediated RNA Decay Is a Unique Vulnerability of Cancer Cells with SF3B1 and U2AF1 MutationsbioRxiv - Cell Biology 2021Quote: ... two gRNAs from a different human gRNA library (AVANA library)118 for each of the 9 genes were cloned into the pLentiCRISPR V2 vector that also expresses Cas9 (Addgene, #52961). Two non-targeting gRNAs were also cloned into the same vector to serve as controls ...
-
bioRxiv - Neuroscience 2020Quote: pFL - AAV-9: pGP-AAV-syn-GCaMP6f-WPRE.24.693 at a titre of 1×1013 GC·ml-1 (Addgene, Watertown, MA, USA).
-
bioRxiv - Neuroscience 2023Quote: ... or VIP-Cre80 mouse lines in combination with the Cre-inducible viral expression of GCaMP6f in the ACC (AAV1/9-SYN-FLEX-GCaMP6f; Addgene, #100833).
-
bioRxiv - Molecular Biology 2024Quote: A non-targeting ‘scramble shRNA’ control sequence and two L1-ORF1-targeting shRNAs [9] were cloned into pLKO.1-TRC (Addgene #10878):
-
bioRxiv - Cancer Biology 2024Quote: ... and pCDH-FLT3L-CAR transferring lentiviral vector as previously described.9 Immortal THP-1 monocytic cells were first transduced with mCherry-encoding lentivirus (Addgene #176016) and sorted by FACS (BD FACSaria FUSION) ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse Mannosidase II amino acids 1-116 was amplified from Addgene plasmid #65261 using a forward primer that contains an XbaI site and a reverse primer with an MluI site and further subcloned upstream of the mCherry open reading frame.
-
bioRxiv - Neuroscience 2023Quote: ... and ectodomain (52-750 amino acids) of the NEP (#7283, Addgene) were used for the fusion protein and then inserted in rAAA-FLEX-axonGCaMP6s-P2A-mRUBY3 vector (#112008 ...
-
bioRxiv - Cancer Biology 2021Quote: ... For generation of KO cell line pools PC-9 and HCC827 cells were transduced with pKLV2-EF1a-Cas9Bsd-W (Addgene ID:68343)[71] to stably express Cas9 ...
-
bioRxiv - Cell Biology 2021Quote: ... this cell line was co-transfected with a 9:1 ratio of pCENP-B-Cherry (a gift from Michael Lampson; Addgene plasmid #45219) and pPGKpuro resistance plasmid ...
-
bioRxiv - Neuroscience 2021Quote: ... The amino acid sequence for the engineered APEX2 was taken from Addgene plasmid #212574 ...
-
bioRxiv - Neuroscience 2023Quote: ... the signal peptide (0-26 amino acids) of pro-opiomelanocortin (#176704, Addgene) and ectodomain (52-750 amino acids ...
-
bioRxiv - Neuroscience 2020Quote: Stereotaxic injection of AAV-EF1a-DIO-HChR2(H134R)-eYFP (serotype 2/1 or 2/9, U. Penn Vector Core, Philadelphia, PA, USA or Addgene, Watertown, MA, USA) was performed in 6-8 weeks old DAT-IRES-Cre or FoxP2-Cre transgenic mice ...
-
bioRxiv - Bioengineering 2022Quote: ... Anti-CD19 and anti-Spike scFv amino acid sequences were obtained from Addgene plasmids #79125 and #155364 ...
-
bioRxiv - Bioengineering 2022Quote: ... Anti-CD19 and anti-HER2 scFv amino acid sequences were obtained from Addgene plasmids #79125 and #85424 ...
-
bioRxiv - Biochemistry 2023Quote: NSD2-PWWP1 (amino acids 211-350) was cloned into a pET28-MHL (RRID:Addgene_26096) vector with a N-terminal His-tag followed by a TEV-cleavage site ...