Labshake search
Citations for Addgene :
251 - 300 of 1330 citations for 5 NITRO BENZO B THIOPHENE 2 CARBOXYLIC ACID METHYL ESTER since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2024Quote: ... 5 µg of pRSV/Rev (Addgene plasmid #12253), and 3.5 µg of pMD2.G (Addgene plasmid #12259 ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 μg pCAS9-mCherry-Frame+1 (Addgene #66940), and 5 μg of pCRISPR-HOT_mNEON plasmid (a kind gift from Hans Clevers ...
-
bioRxiv - Developmental Biology 2021Quote: ... a FoxO1 plasmid encoding a deleted DNA binding domain (amino acid 208-220) was used (Addgene #10694). After 24 hours ...
-
bioRxiv - Biophysics 2021Quote: ... consisting of the human brain isoform B of fyn (confirmed by BLAST alignment) was a gift from Filippo Giancotti (Addgene plasmid # 16032)(Mariotti et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... this cell line was co-transfected with a 9:1 ratio of pCENP-B-Cherry (a gift from Michael Lampson; Addgene plasmid #45219) and pPGKpuro resistance plasmid ...
-
bioRxiv - Microbiology 2023Quote: ... resistance flanked by the 5’ region of VDU and part of the VDU coding sequence was prepared by PCR using the plasmid pTREX-b-NLS-hSpCas9 (a gift from Rick Tarleton, Addgene plasmid #62543) as template and the donor TcVDU84BlastFOW and donor TcVDU84BlastREV ...
-
bioRxiv - Genetics 2023Quote: A phenotypically WT (ROSA+/cre CTIPc/c Bcl2+) v-abl immortalized B cell line was infected with lentivirus for doxycycline-inducible SpCas9 (Addgene Plasmid #50661). Single clones were generated and screened for high SpCas9 inducibility after doxycycline treatment (Sigma Aldrich ...
-
bioRxiv - Genetics 2023Quote: ... FlpOM was generated by introducing the human b-globin intron from CreM into a codon optimized Flp (Raymond and Soriano, 2007; Addgene plasmid # 13792), interrupting the coding sequence between amino acids 159 and 160 ...
-
bioRxiv - Cell Biology 2023Quote: ... two shRNAs targeting EZH2 (shEZH2-a: CCGGCCCAACATAGATGGACCAAATCTCGAGATTTGGTCCATCTATGTTGGGTTTTT G and shEZH2-b: CCGG CGGAAATCTTAAACCAAGAATCTCGAGATTCTTGGTTTAA GA TTTCCG TTTTTG) were designed and cloned into pLKO.1 vector (Addgene plasmid #10879) according to method by Moffat ...
-
bioRxiv - Cell Biology 2024Quote: ... Specific gRNAs against mouse Cyri-b (ex3: CACCGGGTGCAGTCGTGCCACTAGT) were cloned into the sPs-U6-gRNA-Cas9 (BB)-2A-GFP vector (Addgene Plasmid #48138) (Ran et al. ...
-
bioRxiv - Cancer Biology 2024Quote: ... the Human GeCKOv2 CRISPR Knockout Pooled Library (A+B) in the lentiGuide-Puro vector backbone (gift from Feng Zhang; Addgene Plasmid # 1000000048) was amplified and purified as directed by Addgene ...
-
bioRxiv - Cancer Biology 2021Quote: ... The shRNAs targeting HDAC1 (5′-CTATGGTCTCTACCGAAAA-3′) and HDAC3 (5′-GCATTGATGACCAGAGTTA-3′) were cloned into pLKO.1-TRC lentiviral vector (Addgene, #10878). For generation of lentivirus ...
-
bioRxiv - Cell Biology 2019Quote: ... non-targeting (5’-CCTAAGGTTAAGTCGCCCTCG-3’) and DDRGK1-targeting (5’-GGCTCTGCTAGTCGGCTTTAT-3’) shRNAs were cloned into pLKO.1 puro construct (Addgene #8453) according to protocol described in Addgene (https://www.addgene.org/tools/protocols/plko/?gclid=Cj0KCQiAm5viBRD4ARIsADGUT25ZCGNPeQSFvLqSwvg2tHDkCc9zOZsLdaUffZzNTRYzI_YOlKFVQdUaAqbfEALw_wcB)
-
bioRxiv - Microbiology 2019Quote: ... TAAGATCTGTTTAGTGGTGATGGTGATGATGTTTTCCCTTTTGACCTGCGTG EphA2 sgRNA constructs oligos: 5-AAACGTGTGCGCTACTCGGAGCCTC-3 and 5-CACCGGAAGCGCGGCATGGAGCTCC-3 were annealed and ligated into a lentiGuide-Puro plasmid (Addgene, # 52963). EphA4 sgRNA constructs ...
-
bioRxiv - Microbiology 2019Quote: ... EphA4 sgRNA constructs: oligos 5-AAACCACAGTACATTTTTGGCACAC-3 and 5-CACCGTGTGCCAAAAATGTACTGTG-3 were annealed and ligated into a lentiGuide-Puro plasmid (Addgene, # 52963). Sequencing was performed for all constructs to confirm the correct sequence.
-
bioRxiv - Immunology 2021Quote: ... TPC2(L564P):GCaMP6s and TPC2(L265P/L564P):CaMP6s sequences were amplified (forward primer, 5’-TCCGAATTCAATGGGTTCTCATCATCATCATCATCA-3’, reverse primer, 5’-GATACCGGTTGCAACTTCGCTGTCATCATTTGTACAAAC-3’) and subcloned into mApple N1-vector (Addgene #54567) via EcoRI und AgeI sites.
-
bioRxiv - Neuroscience 2020Quote: ... via the primers 5’ GGAATTCATAGGGCGGCCGGGAA 3’ and 5’ AGCGCTGGCCGGCCGTTTAAAC 3’ and was cloned into plasmid AAV-PGK-Cre (Addgene plasmid # 24593) between the AfeI (NEB ...
-
bioRxiv - Biochemistry 2021Quote: ... shRNA targeting mSARM1 (5’-CCGGCTGGTTTCTTACTCTACGAATCTCGAGATTCGTAGAGTAAGAAACCAGTTTTTG-3’) or the scrambled shRNA (5’-CCGGCCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGGTTTTTG-3’) were inserted to pLKO.1-puro (Addgene, #8453) with EcoRI and AgeI ...
-
bioRxiv - Genomics 2021Quote: ... two guide RNA sequences (gRNA 5’ TTGGGGGGGCTACTGCCAGC 3’ and 5’ CTTGAACGCCACCCTCTAAC 3’) were cloned into pspCas9(BB)-2A-GFP (Addgene; #48138) and pspCas9(BB)-2A-RFP (Addgene ...
-
bioRxiv - Biophysics 2022Quote: Human kinesin-5 (Kif11/Eg5) 5-513 was PCR amplified from mCherry-Kinesin11-N-18 plasmid (gift from Michael Davidson, Addgene # 55067). This fragment was previously shown to form functional dimers [19] ...
-
bioRxiv - Molecular Biology 2021Quote: ... the annealed oligos to target CRY1 (Sense: 5′ CACCGCCTTCAGGGCGGGGTTGTCG 3′; and Antisense: 5′ AAACCGACAACCCCGCCCTGAAGGC 3’) was inserted into BsmBI of LentiCRISPRv2 plasmid (Addgene #: 52961).
-
bioRxiv - Pathology 2019Quote: ... the full length genomic copy with promoter of MoDNM1 was amplified with MoDnm1-F (5’-AATT GAATTC GTTGAGCAGGCCGAGCGAC-3’) and MoDnm1-R (5’-AATT GAATTC CACTGGCATTTGATTACGCAAGG-3’) inserted into pFGL822 (Addgene, 558226) and introduced into the Modnm1Δ strain.
-
bioRxiv - Biophysics 2019Quote: ... The LRRK2 gene was cloned by using the primer sets: 5’-GCGATAACATGGCTAGTGGCAGC-3’ and 5’-GGGGTTATGCTAGTTACTCAACAGATGTTCGTCTC-3’ with pENTR221-LRRK2 (Addgene #39529) as the template ...
-
bioRxiv - Biochemistry 2021Quote: ... guide sequences 5’GGCATTGCCCGTCATGGCCC3’ and 5’GTCTTCACCGAGCTCATTAA3’ were cloned into pX330-U6-Chimeric_BB-CBh-hSpCas9 (a gift from Feng Zhang; Addgene plasmid # 42230) and co-transfected with a GFP-expressing plasmid into HCT116 cells using Lipofectamine 2000 ...
-
bioRxiv - Molecular Biology 2021Quote: ... of plasmids expressing sgRNAs (5′- ATTGTGATATCCGATAGTGAT-3′ and 5′-GTTCTGTCAGTGTGAAGAGG-3′) and Cas9 followed by the 2A-Puromycin cassette (pX459, Addgene #62988). 24 h after transfection ...
-
bioRxiv - Cell Biology 2019Quote: ... the Bmal1 coding sequence was cloned from mouse embryonic cDNA (forward primer: 5’ GGCGAATTCGCGGACCAGAGAATGGAC 3’; reverse primer: 5’ GGGCTCGAGCTACAGCGGCCATGGCAA 3’) and subcloned into the pBABE retroviral expression vector (Addgene, 1764). Retroviral vectors were transfected into Phoenix packaging cells ...
-
bioRxiv - Cancer Biology 2022Quote: ... Oligos 5’ CACCGATCACCCTCTTCGTCGCTT 3’ / 5’ AAACAAGCGACGAAGAGGGTGATC 3’ and 5’ CACCGCTTAGGCCGGAGCGAGCCT 3’/ 5’ AAACAGGCTCGCTCCGGCCTAAGC 3’ were annealed and cloned into the px458 cut with BsaI (Addgene #48138). Plasmids were transfected into cell lines using Genejuice transfection reagent (Merck ...
-
bioRxiv - Cancer Biology 2022Quote: ... gRNA sequences targeting Apc (5-CAACTTCTGGTAATGGTC-3) or Trp53 (5-AATGAGGCCTTGGAACTCA-3) were cloned into the Px330 vector (Addgene plasmid #42230). Organoids were removed from Matrigel using Dispase II (Gibco) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... was PCR amplified from genomic DNA using primers (5’ CAGGTCTCAATCCCGATGTAGAACGCGAG 3’) and (5’ CGGTCTCACATATTGTTTCCTTTCTTTATTCACCGG 3’) and was cloned immediately upstream of SpCas9 amplified from plasmid PX165 (Addgene #48137) (62 ...
-
bioRxiv - Cell Biology 2023Quote: ... the primers 5’-AAACCTGGACCCCACCCCCAGATC-3’ and 5’-CACCGATCTGGGGGTGGGGTCCAG-3’ were annealed and cloned in the px458-pSpCas9(BB)-2A-GFP (Addgene, #48138) using the BpiI restriction site to generate a guide RNA ...
-
bioRxiv - Genomics 2023Quote: ... Guide RNAs (FANCC: 5’-GCAAGAGATGGAGAAGTGTA-3’ and MSH2: 5’-GTGCCTTTCAACAACCGGTTG-3’) were cloned into pSpCas9(BB)-2A-GFP (PX458) vector (Addgene#48138). AHH-1 cells were transfected using Lipofectamine 2000 (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2023Quote: ... The SIYx3-GFP insert was generated with the primers: 5’-GGTGTCGTGAGGATCCACCATGGTGTCTATTTACAGGTAC-3’ 5’-CGCCCTCGAGGAATTCTTACTTGTACAGCTCGTCCATGC-3’ and cloned into pLV-EF1a-IRES-Blast (Addgene #85133) linearized with BamHI and EcoRI restriction enzymes (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... mCherry-iLID was amplified using 5’-GGTAGTAGTGGTAGTAGTATGGTGAGCAAGGGCGA-3’ and 5’-TCGAAGCTTGAGCTCGAGATCTTTAAAAGTAATTTTCGTCGTTCGCT-3’.The fragments were inserted into a pEGFP-C1 vector (Addgene 46956) using the AgeI/BglII restriction sites.
-
bioRxiv - Developmental Biology 2024Quote: ... gcgtgtgttcccagatgtat) and PCR donor generated with primers AP677/678 (5’Biotin::taagtgccaaggctgccaggcgtgtgttcccagaaacaccccaggaatcaacc and 5’Biotin::gtttttactcacccgatcgcctttctcaccaatacacttgtcatcgtcatccttg) on plasmid AP635 (Addgene #99485). Genotyping shows scarless insertion in the coding sequence ...
-
bioRxiv - Neuroscience 2023Quote: ... 1:2 dilution) or AAV5-pCAG-FLEX-EGFP-WPRE (1.1 x 1013 gc/ml, Addgene; 1:2 dilution) was injected in VTA (from bregma ...
-
bioRxiv - Cell Biology 2020Quote: ... pPD118.33 (Pmyo-2∷GFP) (Addgene plasmid #1596) at 5 ng/μl and pBSKS (Stratagene ...
-
bioRxiv - Microbiology 2022Quote: ... pDONR223 SARS-CoV-2 NSP2 (Addgene, 141256) and expression clones with N-terminal fusion tags were produced simply by Gateway cloning (Gateway™ LR Clonase™ II Enzyme mix ...
-
bioRxiv - Microbiology 2022Quote: ... pDONR207 SARS-CoV-2 NSP1 (Addgene, 141255), pDONR223 SARS-CoV-2 NSP2 (Addgene ...
-
bioRxiv - Genomics 2020Quote: ... pCFJ90 - Pmyo-2∷mCherry∷unc-54utr (Addgene plasmid # 19327 ...
-
bioRxiv - Cancer Biology 2019Quote: ... or into lentiCRISPR ver.2 (Addgene, #52961) using the BsmBI (New England Biolabs ...
-
bioRxiv - Neuroscience 2020Quote: [2] GAL4d from pBPGAL4.1Uw (Addgene plasmid #26226)(Primers:ADdomain,forward,5’-caggcggccgccataTGCATGGATCCGCCAACTTC AACCAGAGTGG-3’ ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 P.1 (Addgene, #170450), SARS-CoV-1 (Addgene ...
-
bioRxiv - Immunology 2022Quote: ... 2 µg pMDLg/pRRE (Addgene plasmid #12251), 4.64 µg pRSV-Rev (Addgene plasmid #12253) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... NKX6.1 in pX330S-2 (Plasmid #58778; Addgene), MAFA in pX330S-3 (Plasmid #58779 ...
-
bioRxiv - Cell Biology 2023Quote: ... and pcDNA3.1-2xFLAG-SREBP-2 (#26807, Addgene). Amplified N-SREBP1a (Ad5-N-SREBP1a) ...
-
bioRxiv - Molecular Biology 2022Quote: ... For overexpressing ACE2 (Addgene, Appendix Table 2) in HPLFs ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and pBMTBX-2 (Addgene plasmid No. 26073) were gifts from Dr ...
-
bioRxiv - Microbiology 2023Quote: ... pDONR223 SARS-CoV-2 NSP6 (Addgene #141260), and pDONR223 SARS-CoV-2 spike (Addgene #149329 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 2 µg pMD2.G (#12259, Addgene) plasmids by using lipofectamine 2000 (Life Technologies) ...
-
bioRxiv - Microbiology 2023Quote: ... pDONR207 SARS-CoV-2 nsp3 (Addgene # 141257), pDONR223 SARS-CoV-2 NSP6 (Addgene #141260) ...