Labshake search
Citations for Addgene :
251 - 300 of 1147 citations for 4 Hydroxy 7 trifluoromethyl quinoline 3 carbohydrazide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... A pcDNA3 flag HA 14-3-3 β plasmid was a gift from William Sellers (Addgene plasmid # 8999; http://n2t.net/addgene:8999; RRID:Addgene_8999). All plasmids were verified by Sanger sequencing and/or long-read sequencing (Iowa IIHG Genomics core or Plasmidsaurus ...
-
bioRxiv - Genetics 2023Quote: ... GFP-3’UTR was PCR amplified using primers (5’-AGCTTGCATGCCTGCAGGTCG-3’ and 5’-AAGGGCCCGTACGGCCGACTA-3’) and plasmid pPD95.75 (Plasmid #1494-Addgene) as the template ...
-
bioRxiv - Molecular Biology 2024Quote: ... SK-BR-3 HER2-knockout (SK-BR-3 KO) were obtained using pSpCas9 BB-2A-Puro (PX459) V2.0 (9200 bp, Addgene) containing a sgRNA sequence (5’-TCATCGCTCACAACCAAGTG-3’ ...
-
bioRxiv - Cell Biology 2024Quote: ... were constructed by inserting annealed synthetic oligomers (5′-CACCgcagctcctgcctctcatcg-3′ and 5′-AAACcgatgagaggcaggagctgc-3′) into the Bbs I site of pX330-U6-Chimeric_BB-CBh-hSpCas9 vector (#42230; Addgene, Watertown ...
-
bioRxiv - Biochemistry 2024Quote: Synthetic complementary oligos targeting POLDIP2 (5’-CACCGCGCGTCGTCGTGGTCGACGC-3’ and 5’-AAACGCGTCGACCACGACGACGCGC -3’) were cloned into PX459-SpCas9 (Addgene, (35)) at the BbsI site ...
-
bioRxiv - Genetics 2024Quote: ... We transduced hiPSCs from two control donors (553-3, male; 3182-3, female) with lentiviral pUBIQ-rtTA (Addgene #20342) and tetO-NGN2-eGFP-NeoR (Addgene #99378 ...
-
bioRxiv - Cell Biology 2022Quote: ... mCardinal-Lifeact-7 was a gift from Michael Davidson (Addgene plasmid # 54663 ; http://n2t.net/addgene:54663 ; RRID:Addgene_54663). Vectashield antifade mounting medium (Vectorlabs ...
-
bioRxiv - Cell Biology 2022Quote: ... The mCh-NLS plasmid was generated by Michael Davidson and obtained from Addgene (mCh-Nucleus-7, #55110). The pericentrin-RFP plasmid (Gillingham & Munro ...
-
bioRxiv - Cancer Biology 2022Quote: ... mEmerald-Rab11a-7 was a gift from Michael Davidson (Addgene plasmid #54245; http://n2t.net/addgene:54245; RRID:Addgene_54245). pTag-RFP-C-h-Rab11a-c-Myc was a gift from James Johnson (Addgene plasmid #79806 ...
-
bioRxiv - Neuroscience 2020Quote: The alrm-QF2 line was generated by subcloning the enhancer region into pPTQF#7-hsp70 (Addgene# 46136) using EcoRI and BamHI ...
-
bioRxiv - Neuroscience 2020Quote: ... A cohort of SOM.iPKR and PKCδ.iPKR mice were injected with bilaterally in CeL with 200 nl of AAV.Eef1a1 Pr.DIO.EGFPL10a (7 × 10^^12 GC/ml, Addgene) for immunohistochemistry experiment; ...
-
bioRxiv - Neuroscience 2021Quote: ... 300 nl of AAVretro-EF1a-mCherry-IRES-Flpo obtained from Addgene (titer, 7 x 10e12 vg/mL) was unilaterally injected in the basal forebrain (0.25 mm AP ...
-
bioRxiv - Cell Biology 2020Quote: ... mCherry-Nucleus-7 plasmid was generated by Michael Davidson and obtained from Addgene (Addgene plasmid no. 55110). Cells were transfected using siRNAs targeting MAD2 sequence 5′-AGAUGGAUAUAUGCCACGCTT-3′ (Qiagen) ...
-
bioRxiv - Cell Biology 2021Quote: ... mCherry-Rab5a-7 was a gift from Michael Davidson (Addgene plasmid # 55126; http://n2t.net/addgene:55126; RRID:Addgene_55126) PH-Btk-GFP was a gift from Tamas Balla (Addgene plasmid # 51463 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The GFP1-10 and GFP11×7 fragments were obtained from plasmids pcDNA3.1-GFP(1-10) (Addgene: 70219) and pACUH-GFP11×7-mCherry-α-tubulin (Addgene ...
-
bioRxiv - Biophysics 2020Quote: ... The sequence was then excised with XbaI and HindIII and inserted into pT7-7 plasmid (Addgene #36046) between the XbaI and HindIII restriction sites to generate a plasmid template construct (pT7-fastFISH (pT7-fF)).
-
bioRxiv - Cell Biology 2024Quote: ... and 7 µg pMD2.G (gift from Didier Trono, Addgene plasmid #12259; http://n2t.net/addgene:12259; RRID:Addgene_12259) using JetPEI (Polyplus Transfection ...
-
bioRxiv - Neuroscience 2024Quote: ... or pAAV-hSyn-EGFP a gift from Bryan Roth (titer ≥ 7×10¹² genome copies per ml; Addgene viral prep # 50465-AAV1 ...
-
bioRxiv - Biophysics 2023Quote: ... EGFP-Vimentin-7 was a gift from Michael Davidson (Addgene plasmid #56439; http://n2t.net/addgene:56439; RRID:Addgene_56439).
-
bioRxiv - Cell Biology 2022Quote: ... mCherry-Rab7a-7 was a gift from Michael Davidson (Addgene plasmid #55127; http://n2t.net/addgene:55127; RRID:Addgene_55127). Lamp1-RFP62 was a gift from Walther Mothes (Addgene plasmid # 1817 ...
-
bioRxiv - Neuroscience 2022Quote: mRuby-Mito-7 was a gift from Michael Davidson (Addgene plasmid #55874; http://n2t.net/addgene:55874; RRID:Addgene_55874). mRuby-ER-5 was a gift from Michael Davidson (Addgene plasmid #55860 ...
-
bioRxiv - Neuroscience 2022Quote: ... for optogenetic control: Two 400 nl injection of AAV2retro-GAG-ChR2 (Addgene 28017, 7 × 1012 VG/ml) or AAV2retro-CaMKIIa-stGtACR2-FusionRed (Addgene 105669 ...
-
bioRxiv - Cell Biology 2023Quote: ... mTagBFP-Nucleus-7 was a gift from Michael Davidson (Addgene plasmid # 55265 ; http://n2t.net/addgene:55265 ; RRID:Addgene_55265). TCAB1 was knocked-out using a single sgRNA or two separate sgRNA and Cas9 encoding plasmids that were transfected alongside a GFP-expressing plasmid ...
-
bioRxiv - Synthetic Biology 2024Quote: ... the LPutopia-8 genome-targeting vector was constructed based on the earlier version LPutopia-7 (Addgene #199212) assembled in the previous studies28 ...
-
bioRxiv - Cell Biology 2024Quote: GFP11 and GFP11×7 plasmids from DNA preparation step in the appropriate reading frame (RRID: Addgene_172068, Addgene_172067). Ten-m is found is phase 1 thus it is possible to use the AddGene plasmids for GFP11 insertions ...
-
bioRxiv - Cell Biology 2024Quote: GFP11 and GFP11×7 plasmids from DNA preparation step in the appropriate reading frame (RRID: Addgene_172068, Addgene_172067). Ten-m is found is phase 1 thus it is possible to use the AddGene plasmids for GFP11 insertions ...
-
bioRxiv - Cell Biology 2024Quote: ... mEmerald-Rab7a-7 was a gift from Michael Davidson (Addgene plasmid # 54244; http://n2t.net/addgene:54244 ; RRID:Addgene_54244). TBC1D5 shRNA lentivirus (GeneCopoeia #LPP-RSH087343-LVRH1MP-200 ...
-
bioRxiv - Neuroscience 2024Quote: ... DV: -1.75) and 0.2μl AAV-hSyn-DIO-hM4D(Gi)-mCherry (44362-AAV5, Addgene, 7×10¹² vg/mL) was injected at a rate of 0.05μl/min ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... To label mitochondria and ER we used the mCherry-Mito-7 (a gift from Michael Davidson - Addgene plasmid # 55102;http://n2t.net/addgene:55102;RRID:Addgene_55102 ...
-
bioRxiv - Cell Biology 2024Quote: ... and 7 μg pMD2.G (gift from Didier Trono (Addgene plasmid #12259; http://n2t.net/addgene:12259; RRID:Addgene_12259)) using JetPEI (101000053 ...
-
bioRxiv - Neuroscience 2020Quote: [4] QF2w-Hsp70frompQF2wWB(Addgene plasmid #61313) (Primers ...
-
bioRxiv - Developmental Biology 2022Quote: ... psPAX2 (4 µg, Addgene plasmid # 12260) and pAdVAntage (1.6 µg ...
-
bioRxiv - Cell Biology 2020Quote: ... 4 μg of psPAX2 (Addgene #12260) and 8 μg of purified pLKO.1 plasmid containing the shRNA constructs upon reaching 70% confluency ...
-
bioRxiv - Developmental Biology 2024Quote: ... 4 μg of psPAX2 (Addgene, 12260), and 6 μg of GIPZ Non-silencing Lentiviral shRNA (control ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4 μg of psPAX2 (Addgene #12260), and 1 μg of pCMV-VSV-G (Addgene #8454 ...
-
bioRxiv - Biophysics 2024Quote: ... was genetically fused to the C-terminus of CD86 (Addgene plasmid #98284),[66] CTLA-4 (Addgene plasmid #98285)[66] and EGFR (Addgene plasmid #32751)[67] by replacing the fluorescent protein (mEos2 or EGFP ...
-
bioRxiv - Developmental Biology 2021Quote: ... The following guides 5’-GGACCTGTTCGGAATCCACC-3’ and 5’-GGGTGAGGTTCTGTCTACCC-3 were separately cloned into the BbsI site of pU6-BbsI-chiRNA plasmid (obtained from Addgene) and both were simultaneously injected by Best Gene into w1118 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and for the downstream guide PUS1dnF 5’-CACCGATAACAGCGGTTAGCGGCA -3’ and PUS1dnR 5’-AAACTGCCGCTAACCGCTGTTATC -3’ were phosphorylated and annealed and then cloned into px458 (Addgene) digested with BbsI ...
-
bioRxiv - Cancer Biology 2020Quote: ... sgRNAs against Luciferase (Luc)(5’-CCCGGCGCCATTCTATCCGC-3’) and USF2 (#2, #3 and #5 as above) were cloned into mCherry-expressing LRCherry2.1 (Addgene #108099) vector.
-
bioRxiv - Cancer Biology 2020Quote: WT RPA1/2/3 and GFP were overexpressed in the PRMT5 KO cell line by co-transfection of WT RPA1/2/3 (Addgene) and pCMV-GFP plasmid with 5:1 ratio ...
-
bioRxiv - Cell Biology 2020Quote: ... guide RNA (gRNA) targeting TMEM41A (5’-GCCGAGAAGCGGGCGCATGT-3’) and TMEM64 (5’-CCGCGCTGGGCCGAGGCATG-3’) were cloned into pSpCas9(BB)-2A-GFP (Addgene #48138 ...
-
bioRxiv - Neuroscience 2020Quote: ... The entire coding sequence of GCaMP6s was amplified by PCR with primers 5’–GGATCCGCCACCATGGGTTCTCATCATCATCA–3’ and 5’–GTAGCCGAACCGGTCTTCGCTGTCATCATTTGTAC–3’ using pGP-CMV-GCaMP6s (Addgene plasmid # 40753 ...
-
bioRxiv - Neuroscience 2022Quote: ... we generated two independent sgRNA lines that targeted the first and sixth exons (sgRNA1: 5’ GGTGTCTTCATTGGCGCCGCTGG 3’; sgRNA2: 5’ CATTGATGGATTCTACTCCCGGG 3’) and cloned each into the pU63 vector (#49410; Addgene). Constructs were sent to BestGene Inc ...
-
bioRxiv - Developmental Biology 2023Quote: ... The oligos (5-taggCCTGACAGTACTCACGAC -3’ and 5’-aaacGTCGTGAGTACTGTCAGG -3’) were annealed and ligated into the pT7-gRNA vector (Addgene #46759)(74 ...
-
bioRxiv - Physiology 2023Quote: ... abcc9 gRNA (5’ CATTGCCACGAAGCTGGCGG 3’) or kcnj8 gRNA (5’ ACGCCACTTCAGGTCTACCA 3’) were cloned into BbsI digested plasmid pX330 (Addgene # 42230). T7 sgRNA template and T7 Cas9 template were prepared by PCR amplification and gel purification ...
-
bioRxiv - Molecular Biology 2022Quote: SUGP1 constructs were cloned from pHA-SUGP1 using primers (IB0156 5’-atgacgtcccagactacgcagctagcAGTCTCAAGATGGACAACC-3’; IB0157 5’-tgtttagcgttcagcagcgggatagatccgcctgaGTAGTAAGGCCGTCTGG-3’) into pCDNA3_3xHA-miniTurbo-NLS (Addgene #107172) digested with NheI-HF (NEB #R3131).
-
bioRxiv - Immunology 2024Quote: ... targeting CYLD was cloned by annealing two DNA oligos (forward, 5’-GTGGTCAAGGTTTCACTGAC-3’; reverse, 5’-GTCAGTGAAACCTTGACCAC-3’) and ligating into lentiCRISPER v2 (52961, Addgene) plasmids ...
-
bioRxiv - Cell Biology 2024Quote: ... the primers 5’-CACCGCATCGCTCCTGCGTCCGCCA-3’ and 5’-AAACTGGCGGACGCAGGAGCGATGC-3’ were annealed and subcloned into px458-pSpCas9(BB)-2A-GFP (Addgene) using the BpiI restriction site to generate a guide RNA ...
-
bioRxiv - Cell Biology 2023Quote: ... two sequences targeting exon 1 of Numb (5’-GAAAGACGTTTATGTCCCAG-3’ and 5’-GGAAGCTACACTTTCCAGTG-3’) were individually cloned into plasmid pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene #62988). These guide constructs were then electroporated into mESCs using the Lonza Nucleofector 2b Device and Cell Nucleofector Kit (Lonza #VAPH-1001) ...
-
bioRxiv - Cell Biology 2022Quote: ... sgRNA for human ATP6V0C (5’-GAATAGTCGGGGCTGCTGGG-3’) and ATP6V0D1 (5’-TCGATGACTGACACCGTCAG-3’) were cloned to lentiCRISPR v2 plasmid (Plasmid #52961, Addgene), followed by virus package and infection procedures as described previously69 ...