Labshake search
Citations for Addgene :
251 - 300 of 1068 citations for 3 Acetyl N ethylpyridinium bromide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... pAAV-hSyn-Flpo-3×FLAG (no. 173047, Addgene), which has the hSyn promoter followed by Flpo with 3×FLAG C-terminal tag (OGS629 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5ng of a reference plasmid (pNL4-3, Addgene) was spiked in to each DNA preparation and used for qPCR normalization (Table S1) ...
-
bioRxiv - Immunology 2021Quote: ... 3 μg of pIRES-eGFP plasmid DNA (Addgene) were digested with 250 U of Benzonase ...
-
bioRxiv - Neuroscience 2020Quote: ... and 3 µg VSVG packaging vector (Addgene, 8454) in a 100 mm dish using a calcium phosphate transfection kit (CalPhos Mammalian Transfection kit ...
-
bioRxiv - Bioengineering 2020Quote: ... 3 μg pCMV-VSV.G (Addgene, Watertown, MA; #8454), and 4 μg CD19-CAR-GFP transfer plasmid (Bloemberg et al ...
-
bioRxiv - Neuroscience 2020Quote: ... pCAG-Flpo (Addgene #125576, 3-10 ng/μL) and pCAFNF-tdTomato (Addgene#125575 ...
-
bioRxiv - Genetics 2020Quote: ... and pCFJ104 Pmyo-3-mCherry (Addgene plasmid 19328)(Frøkjær-Jensen et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... a p10 3’UTR fragment amplified from Addgene plasmid #100580 with primers 1010.C5 and 1010.C6 ...
-
bioRxiv - Bioengineering 2020Quote: ... a p10 3’UTR fragment amplified from Addgene plasmid #100580 19 with primers 986.C3 and 986.C4 ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 3 μg of pCXWB-EBNA1 (Addgene #37624) were co-nucleofected into 1×106 primed hiPSCs using the Lonza 4D-nucleofector (“Primary Cell P3” solution ...
-
bioRxiv - Molecular Biology 2024Quote: ... pN3-3×Flag-Control was purchased from Addgene (Watertown ...
-
bioRxiv - Neuroscience 2023Quote: ... and 3) AAV9-hSyn-ChR2(H134R)-eYFP (RRID:Addgene_127090 ...
-
bioRxiv - Neuroscience 2023Quote: ... muscarinic receptor type 3/1 (CHRM3/1, Addgene) and GFP were co-expressed at a ratio of 8:4:3:1 ...
-
bioRxiv - Neuroscience 2023Quote: ... and ipo13b sgRNA3 into pU6b:sgRNA#3 (Addgene #64247). Ligation reactions were carried out by mixing 1 µL 10x NEB CutSmart buffer ...
-
bioRxiv - Cell Biology 2024Quote: mCherry-ER-3 (mCherry-KDEL; Addgene plasmid #55041) and mEmerald-TGNP-N-10 (Addgene plasmid #54279 ...
-
bioRxiv - Cell Biology 2024Quote: ... pGEX-4T-3-mR7BD (Addgene #79149, Edinger Lab), mCherry (Clontech) ...
-
bioRxiv - Immunology 2024Quote: ... and pCS2-HA-14-3-3η (Addgene #116887) were a gift from Feng-Qian Li & Ken-Ichi Takemaru (Li et al ...
-
bioRxiv - Bioengineering 2024Quote: ... Separately 3 μg of pMD2.G (Addgene #12259), 12 μg of pCMV delta R8.2 (Addgene #12263 ...
-
bioRxiv - Cell Biology 2024Quote: ... and pCFJ104 (Pmyo-3::mCherry, Addgene #19328 [86]). The site of mAID::mNG insertion was verified by PCR on the genomic DNA of homozygous progeny ...
-
bioRxiv - Cell Biology 2024Quote: ... BCL2L13 I224A/L227A/W276A/I279A (ΔLIR1+3) (RRID:Addgene_223754), BCL2L13 W276A/I279A/I307A/V310A (ΔLIR1+4 ...
-
bioRxiv - Biochemistry 2024Quote: ... (1/2)NORAD-4xenv8-FL-3’antiPNA (Addgene plasmid #199208), or (1/8)NORAD-4xenv8- FL-3’antiPNA (Addgene plasmid #199209) ...
-
bioRxiv - Biochemistry 2020Quote: ... and inserted into UC Berkeley Macrolab vector 1GFP (KanR, N-terminal His6-GFP fusion; Addgene #29663). Plasmids were transformed into E ...
-
bioRxiv - Cell Biology 2022Quote: ... Constructs encoding the DFCP1 N-terminus were cloned into pET-His6-MBP-TEV-LIC (Addgene # 29708) and Rosetta2(DE3 ...
-
bioRxiv - Biochemistry 2022Quote: FUS SYQG LC containing a TEV cleavable N-terminal histidine tag (RP1B FUS LC, AddGene #127192), full-length FUS with an N-terminal histidine tag and maltose-binding protein fusion (pTHMT FUS 1-526 ...
-
bioRxiv - Cell Biology 2022Quote: ... MAC (BirA-Ha-Strep-tag II)-N was a gift from Markku Varjosalo (Addgene plasmid # 108078). FLAG-tagged TR-TUBE has been previously published (Yoshida et al. ...
-
bioRxiv - Genomics 2021Quote: ... vectors by replacing the Cas9 and puromycin N-acetyltransferase sequences in lentiCRISPR v2 plasmid (Addgene, 52961) with hygromycin B phosphotransferase and EGFP or mCherry sequences ...
-
bioRxiv - Biophysics 2021Quote: ... coli expression vector with an N-terminal 6xHis tag followed by an MBP tag (Addgene #29654) by ligation independent cloning (LIC) ...
-
bioRxiv - Neuroscience 2023Quote: ... Entry vectors were transferred into pDEST-CMV-N-EGFP (24) (Prof. Robin Ketteler, AddGene clone 122842) and/or pdcDNA-FlagMyc (B ...
-
The Hippo pathway terminal effector TAZ/WWTR1 mediates oxaliplatin sensitivity in colon cancer cellsbioRxiv - Cancer Biology 2023Quote: Murine Taz was expressed by transfecting cells with pEF-TAZ-N-Flag from Michael Yaffe (Addgene #19025 ...
-
bioRxiv - Cell Biology 2024Quote: ... For N-terminal tagging a repair donor plasmid consisting of mCherry2 (derived from Addgene plasmid # 72831), flanked by a total of 6X Flag repeat epitope tags was generated ...
-
bioRxiv - Neuroscience 2023Quote: ... or GFP and Synaptophysin-RFP cDNA (pRVdG-N-P-M-EGFP-SynPhRFP-L, Addgene plasmid #52483), and with these additional plasmids ...
-
bioRxiv - Cell Biology 2022Quote: Human PFKFB3 tagged with N-terminal GFP was cloned into the viral plasmid pWPXL (Addgene #12257). A PFKFB3 mutant (nuc-free PFKFB3 ...
-
bioRxiv - Genetics 2023Quote: ... Various Npu intein-split ABE constructs were cloned into N- and C-terminal AAV vectors (Addgene plasmids 137177 and 137178 ...
-
bioRxiv - Cancer Biology 2021Quote: ... The shRNAs targeting HDAC1 (5′-CTATGGTCTCTACCGAAAA-3′) and HDAC3 (5′-GCATTGATGACCAGAGTTA-3′) were cloned into pLKO.1-TRC lentiviral vector (Addgene, #10878). For generation of lentivirus ...
-
bioRxiv - Immunology 2021Quote: ... TPC2(L564P):GCaMP6s and TPC2(L265P/L564P):CaMP6s sequences were amplified (forward primer, 5’-TCCGAATTCAATGGGTTCTCATCATCATCATCATCA-3’, reverse primer, 5’-GATACCGGTTGCAACTTCGCTGTCATCATTTGTACAAAC-3’) and subcloned into mApple N1-vector (Addgene #54567) via EcoRI und AgeI sites.
-
bioRxiv - Neuroscience 2020Quote: ... via the primers 5’ GGAATTCATAGGGCGGCCGGGAA 3’ and 5’ AGCGCTGGCCGGCCGTTTAAAC 3’ and was cloned into plasmid AAV-PGK-Cre (Addgene plasmid # 24593) between the AfeI (NEB ...
-
bioRxiv - Biochemistry 2021Quote: ... shRNA targeting mSARM1 (5’-CCGGCTGGTTTCTTACTCTACGAATCTCGAGATTCGTAGAGTAAGAAACCAGTTTTTG-3’) or the scrambled shRNA (5’-CCGGCCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGGTTTTTG-3’) were inserted to pLKO.1-puro (Addgene, #8453) with EcoRI and AgeI ...
-
bioRxiv - Genomics 2021Quote: ... two guide RNA sequences (gRNA 5’ TTGGGGGGGCTACTGCCAGC 3’ and 5’ CTTGAACGCCACCCTCTAAC 3’) were cloned into pspCas9(BB)-2A-GFP (Addgene; #48138) and pspCas9(BB)-2A-RFP (Addgene ...
-
bioRxiv - Biochemistry 2021Quote: ... two double-stranded oligonucleotides targeting exon 2 of human SGTA (guide #1: 5′-CATGACCAGCTCCGGCACGG-3′ and guide #2: 5′- CAGGAACTGGATGATGGCGT-3′) were ligated into the pSpCas9(BB)-2A-puro vector (Addgene #62988) using BbsI sites ...
-
bioRxiv - Molecular Biology 2021Quote: ... the annealed oligos to target CRY1 (Sense: 5′ CACCGCCTTCAGGGCGGGGTTGTCG 3′; and Antisense: 5′ AAACCGACAACCCCGCCCTGAAGGC 3’) was inserted into BsmBI of LentiCRISPRv2 plasmid (Addgene #: 52961).
-
bioRxiv - Cancer Biology 2021Quote: ... two separate NR2F1 guide RNAs (guide 2: 5’-GATCCGCAGGACGACGTGGC-3’ and guide 4: 5’-GGCTGCCGTAGCGCGACGTG-3’) were cloned into pLentiCRISPRv2 (Addgene #52961). A non-targeting (NT ...
-
bioRxiv - Molecular Biology 2021Quote: ... of plasmids expressing sgRNAs (5′- ATTGTGATATCCGATAGTGAT-3′ and 5′-GTTCTGTCAGTGTGAAGAGG-3′) and Cas9 followed by the 2A-Puromycin cassette (pX459, Addgene #62988). 24 h after transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... the primers 5’-AAACCTGGACCCCACCCCCAGATC-3’ and 5’-CACCGATCTGGGGGTGGGGTCCAG-3’ were annealed and cloned in the px458-pSpCas9(BB)-2A-GFP (Addgene, #48138) using the BpiI restriction site to generate a guide RNA ...
-
bioRxiv - Synthetic Biology 2023Quote: ... was PCR amplified from genomic DNA using primers (5’ CAGGTCTCAATCCCGATGTAGAACGCGAG 3’) and (5’ CGGTCTCACATATTGTTTCCTTTCTTTATTCACCGG 3’) and was cloned immediately upstream of SpCas9 amplified from plasmid PX165 (Addgene #48137) (62 ...
-
bioRxiv - Immunology 2024Quote: HEK293T cells were transfected with 3 µg of pmirGLO plasmid containing the 3’UTR of Zc3h12a or Tnf (Addgene plasmid 207127) (7 ...
-
bioRxiv - Cell Biology 2023Quote: ... mCherry-iLID was amplified using 5’-GGTAGTAGTGGTAGTAGTATGGTGAGCAAGGGCGA-3’ and 5’-TCGAAGCTTGAGCTCGAGATCTTTAAAAGTAATTTTCGTCGTTCGCT-3’.The fragments were inserted into a pEGFP-C1 vector (Addgene 46956) using the AgeI/BglII restriction sites.
-
bioRxiv - Cancer Biology 2023Quote: ... or FAXDC2 sg RNAs (sg3 5’-TCTTGTTCTACTATTCACAC-3’, sg4-TGGGGAAAGATATCATGCAC-3’) were cloned into was cloned into FgH1tUTG or FgH1tUTCyan plasmid (Addgene #85551) plasmids respectively ...
-
bioRxiv - Immunology 2023Quote: ... The SIYx3-GFP insert was generated with the primers: 5’-GGTGTCGTGAGGATCCACCATGGTGTCTATTTACAGGTAC-3’ 5’-CGCCCTCGAGGAATTCTTACTTGTACAGCTCGTCCATGC-3’ and cloned into pLV-EF1a-IRES-Blast (Addgene #85133) linearized with BamHI and EcoRI restriction enzymes (NEB ...
-
bioRxiv - Cancer Biology 2022Quote: ... gRNA sequences targeting Apc (5-CAACTTCTGGTAATGGTC-3) or Trp53 (5-AATGAGGCCTTGGAACTCA-3) were cloned into the Px330 vector (Addgene plasmid #42230). Organoids were removed from Matrigel using Dispase II (Gibco) ...
-
bioRxiv - Genomics 2023Quote: ... Guide RNAs (FANCC: 5’-GCAAGAGATGGAGAAGTGTA-3’ and MSH2: 5’-GTGCCTTTCAACAACCGGTTG-3’) were cloned into pSpCas9(BB)-2A-GFP (PX458) vector (Addgene#48138). AHH-1 cells were transfected using Lipofectamine 2000 (Thermo Fisher Scientific) ...