Labshake search
Citations for Addgene :
2901 - 2950 of 3780 citations for 6 9 Ethano 4H imidazo 4 5 d pyridazino 1 2 a pyridazin 4 one 2 butyl 3 6 7 8 9 11 hexahydro 6 9 dimethyl 3 2' 2H tetrazol 5 yl 1 1' biphenyl 4 yl methyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... F-tractin and Linker 1 were derived from pEGFP-C1 F-tractin-EGFP (Addgene Plasmid #5847)48 ...
-
bioRxiv - Biochemistry 2023Quote: ... Mouse H2A.Z.1 gene in pIND-EGFP was a kind gift from from Danny Rangasamy (Addgene plasmid # 15770 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Human FUS (residues 1-214) was amplified by PCR using pHR-FUSN-mCh-Cry2WT (Addgene #101223). The IDRs fragments were fused with TPPPCORE domain(aa.45-166 ...
-
bioRxiv - Neuroscience 2023Quote: ... pcDNA3.1 Dynamin 1 (human, p880) was a gift from Sandra Schmid and was obtained from Addgene (Addgene plasmid #34682 ...
-
bioRxiv - Microbiology 2024Quote: GECs were transfected with 1 µg of pFLAG-CMV2-Hsp27-S78D/S82D (Addgene plasmid # 85187 [69]), a constitutively activated HSp27 construct ...
-
bioRxiv - Neuroscience 2024Quote: ... All shRNA plasmids were made by digesting pLKO.1 hPGK-BFP TRC cloning vector (Addgene #191566) with AgeI-HF and EcoRI-HF and ligating annealed shRNA sequences with Quick Ligase Buffer (NEB ...
-
bioRxiv - Neuroscience 2024Quote: Primary rat hippocampal neurons at DIV3 were infected with pLKO.1-TRC mTagBFP2 (Addgene, plasmid #191566) to express JPH3 shRNA (from OrigGene ...
-
bioRxiv - Cancer Biology 2024Quote: The shRNA sequences were inserted into the pLKO.TRC.1 plasmid (Addgene, Cat#10878, RRID: Addgene_10878, Addgene).
-
bioRxiv - Cancer Biology 2024Quote: The shRNA sequences were inserted into the pLKO.TRC.1 plasmid (Addgene, Cat#10878, RRID: Addgene_10878, Addgene).
-
bioRxiv - Neuroscience 2024Quote: All shRNA plasmids were made by digesting pLKO.1 hPGK-BFP TRC cloning vector (Addgene #191566) with AgeI-HF and EcoRI-HF and annealed shRNA sequences were ligated with Quick Ligase Buffer (NEB) ...
-
bioRxiv - Neuroscience 2024Quote: ... The AAV11 capsid gene58 was synthesized and inserted into the pAAV2/1 helper vector (Addgene #112862). The following viruses were used in this study ...
-
bioRxiv - Cell Biology 2022Quote: ... IFT121 and IFT139 in IMCD-3 cells were designed using Benchling software and cloned into the pX330 vector (gift from Feng Zhang; Addgene plasmid # 42230; (Cong et al., 2013)) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The alleles also contain mutations that confer resistance to CRISPR/Cas9 editing (without changing the amino acid sequence) with all the sgRNAs against LKB1 in the Toronto Knockout version 3 (TKOv3) CRISPR library (Addgene 125517, a gift from Jason Moffat). These alleles were then cloned into pBABE-GFP (Addgene 10668 ...
-
bioRxiv - Developmental Biology 2024Quote: ... and guide RNAs were cloned into plasmid pCFD3-dU6:3 (for Dlp, Mad and Med) or pCFD4-U6:1_U6:3 (for Babo, Brk, Dad, Sax, Shn, Smad2 and Wit) (Addgene #49410 and #49411, (Port et al., 2014)) ...
-
Pathogenic variants of sphingomyelin synthase SMS2 disrupt lipid landscapes in the secretory pathwaybioRxiv - Cell Biology 2022Quote: ... The inserts of the pENTR™11 constructs were transferred into the lentiviral expression vector pInducer20 (Addgene, 44012) using Gateway cloning (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... using primer sequences 5’-TGTACCGGTCTCGAGGCCACCAT-GGTGGGTGAGG and 5’-AGATCCGGAGCTGTG-CCCCAGTTTGCTA, and cloned in place of EGFP in pT7-EGFP-C1-HsDCP1a (Tritschler et al., 2009) (Addgene # 25030). We then excised the FP635-DC-P1a cassette and blunt cloned into d2EGFPβ-glo-bin-UTR in place of the d2EGFP coding region.
-
bioRxiv - Molecular Biology 2020Quote: ... All cell lines used to assess mitotic progression (Figures 5 and S7) were generated by co-transfecting pcDNA3 encoding mCherry-tagged Histone H2B (Addgene: 20972) and pcDNA3 encoding GFP-tagged Lamin B1 (a kind gift from David Vaux) ...
-
bioRxiv - Developmental Biology 2019Quote: ... Oligonucleotides encoding sgRNA protospacer sequences (Extended Data Table 5) were annealed and cloned into pX330-U6-Chimeric_BB-CBh-hSpCas9 (a gift from Feng Zhang, Addgene plasmid # 42230) as described previously47 ...
-
bioRxiv - Cell Biology 2019Quote: ... The pDB070.iodo.5 plasmid containing the modified tRNA and tRNA synthetase for p-iodo-L-phenylalanine incorporation was obtained from Addgene (#99397) as a gift from David Liu [31] ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 sgRNAs targeting DIS3L2 (generated using the ChopChop tool (Labun et al., 2019)) were cloned into lentiGuide-Puro (Addgene #52963). The individual sgRNAs were subsequently transduced into MCF10a cells stably expressing pHR-SFFV-dCas9-BFP-KRAB (Addgene #46911 ...
-
bioRxiv - Cell Biology 2021Quote: ... 5’CACCGTGCAGCCCCCATAGCAGGTG and 5’AAACCACCTGCTATGGGGGCTGCAC) were synthesized by ID&T (Leuven, Belgium) and cloned into the pSpCas9(BB)-2A-Puro plasmid (pXP459, Addgene #48139). HeLa cells were co-transfected with the two RNF213-targeting plasmids with Lipofectamine 3000 (L3000008 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Lentiviruses delivering sgRNA were packed by transfecting about 70% confluent HEK293T cells cultured in T75 flasks with 5 µg pCMV-VSVG (Addgene 8454), 10 µg pCMV-dR8.2 dvpr (Addgene 8455) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Synthetic and control promoter parts were assembled with the omega 5’ untranslated region from tobacco mosaic virus (5UTR-ΩTMV; pICH41402, Addgene #50285), the coding sequence of firefly luciferase (LucF ...
-
bioRxiv - Microbiology 2021Quote: Design of the guide RNA targeting the region between Dicer 5’-UTR and its first coding exon for CRISPR/Cas9 mediated knock-in was carried out using the CRISPOR Design Tool [86]. Annealed oligonucleotide corresponding to the gRNA (Supp. Table 5) were cloned into the vector pX459 (Addgene #48139) which also encodes S ...
-
bioRxiv - Cell Biology 2021Quote: ... and 1.5 million cells were resuspended in Mirus nucleofector solution and electroporated with 5 ug of px458 plasmid (Addgene plasmid #48138) containing a small guide RNA (see Table S1 for oligonucleotide information ...
-
bioRxiv - Neuroscience 2020Quote: ... cells were transfected with a combination of three plasmids: 5 μg of pMD2.G (gift from Didier Trono, Addgene plasmids #12259), 15 μg of psPAX2 (gift from Didier Trono ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmids were then linearized with MluI and 2μg of plasmid was transfected into 5×105 HEK293 cells together with a plasmid encoding the T7 polymerase 63 (Addgene 65974) using calcium phosphate ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 x 104 MDCK II cells were transiently transfected with pSpCas9(BB)-2A-Puro (PX459) plasmids (Addgene, plasmid #62988, MA, USA) (Ran et al. ...
-
bioRxiv - Plant Biology 2023Quote: ... and MOM1 CMM2 domain (aa1660-aa1860)5 were first cloned into gateway entry vectors followed by LR reaction with pGBKT7-GW (Addgene 61703) and pGADT7-GW (Addgene 61702 ...
-
bioRxiv - Neuroscience 2024Quote: ... two 5 weeks old rats habituated to tickling underwent unilateral injection of 100 nl at 30 nl/min of AAV2/5.hsyn.eGFP (Addgene, 50465-AAV5) in the insular cortex at the following coordinates ...
-
bioRxiv - Genomics 2024Quote: ... respectively),25 modified scaffold sequence was 5′GTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAA AAAGTGGCACCGAGTCGGTGC,60 and RNA structural motif for epegRNAs was tevopreQ1 (5′-CGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAA).40 pegRNAs and epegRNAs used the pU6-sgRNA-EF1Alpha-puro-T2A-BFP (Addgene #60955)35 backbone ...
-
bioRxiv - Cell Biology 2023Quote: ... 25 μg of pT/Caggs-NRASV12 or pT/Caggs-NRASV12/D38A and 5 μg of PT2/c-Luc//PGK-SB-13 (Addgene, 20207) were suspended in 0.9% saline solution at a final volume of 10% of the body weight and injected via the tail vein within 8 seconds ...
-
bioRxiv - Neuroscience 2023Quote: ... 2014) AAV2-hSyn-DIO-hM4D(Gi)- mCherry vector (titer ≥ 5×10¹² vg/mL) was attained from AddGene (catalog number 44362-AAV2). Rats were anesthetized with 2.5% isoflurane ...
-
bioRxiv - Genomics 2023Quote: ... a plasmid encoding a sgRNA that targets the 5’ coding sequence of bc10 (GP01409) was co-injected with pCRISPaint-T2A-Gal4-3xP3-RFP (Addgene #127556) into nos-Cas9attP40 embryos ...
-
bioRxiv - Plant Biology 2023Quote: ... The construct contains a Cas9 expression cassette driven by the CaMV 2×35S promoter and 5’UTR and guide RNA (Ueta et al. 2017) scaffold driven by the AtU6 promoter (Kamoun Lab, Addgene #46968). The AtU6-gRNA-7xT fragment was cloned into level-1 plasmid (SlIAA9-gRNA3 ...
-
bioRxiv - Microbiology 2023Quote: ... lentiviral particles pseudotyped with the VSV-G protein were produced by cotransfecting HEK293T cells in 10cm dishes with 5 mg pLentiCMVPuroDEST vector (Addgene, #17452), 2 mg VSV-G Env expression vector pMD2.G (Addgene #12259 ...
-
bioRxiv - Neuroscience 2023Quote: ... Two gRNA spacer sequence targeting the 5’UTR immediately before the start codon of gcm were first cloned into pAC-U63-tgRNA-nlsBFPnls (Addgene 169029) (78 ...
-
bioRxiv - Cell Biology 2023Quote: The PM-targeting sequence MyrPalm was amplified by PCR and ligated at the 5’ of the cameleon D1cpv-encoding sequence (Addgene #37479) into pcDNA3.
-
bioRxiv - Cancer Biology 2024Quote: 293T cells (1.5 x 106 cells in a 10-cm dish) were transfected with the pCDH-puro-CMV-VC3AI lentiviral vector (Addgene, 78907) using Lipofectamine 2000 ...
-
bioRxiv - Physiology 2022Quote: ... Maternal hepatocyte-specific YAP1 deletion was achieved by injecting mice with the adeno-associated virus serotype 8 (AAV8) with the thyroxine-binding globulin promoter (TBG) promoter expressing Cre (AAV8-TBG-Cre virus, Addgene, AV-8-PV1091) via tail vein at a dose of 1×1012 genomic copies/mouse ...
-
bioRxiv - Cell Biology 2021Quote: ... mEos2-Actin-7 was a gift from Michael Davidson (Addgene plasmid # 57339)(87) ...
-
bioRxiv - Neuroscience 2020Quote: ... 7 mice) or AAV2-hSyn-DIO-mCherry (4.7 × 1012 particles/mL; Addgene, Catalog number 50459-AAV2 ...
-
bioRxiv - Neuroscience 2019Quote: ... mCherry-Lifeact-7 was a gift from Michael Davidson (Addgene plasmid # 54491)
-
bioRxiv - Molecular Biology 2021Quote: ... The 8x let-7 BS psiCHECK2 plasmid was acquired from Addgene (#20931), and the 3x miRNA BS psiCHECK2 plasmids (used in Suppl ...
-
bioRxiv - Molecular Biology 2020Quote: ... or empty EGFP plasmid and an mRaspberry-Mito-7 plasmid (Addgene #55931) to localize mitochondria ...
-
bioRxiv - Immunology 2020Quote: ... mCardinal-Lifeact-7 was a gift from Michael Davidson (Addgene plasmid #54663). Transfection with plasmid was performed following standard protocols for Fu gene 6 (Promega ...
-
bioRxiv - Neuroscience 2019Quote: ... an eGFP-only reporter without DREADDs (n=7; Addgene: AAV2-hSyn-eGFP), was employed in a group of control rats [65–67].
-
bioRxiv - Biochemistry 2019Quote: ... WT αSyn/pT7-7 plasmid was procured from Addgene (www.addgene.com; plasmid #36046). This vector was also used as a backbone for cloning His6-tagged WT-αSyn by PCR amplification.
-
bioRxiv - Cell Biology 2021Quote: ... EBFP2-Mito-7 was a gift from Michael Davidson (Addgene plasmid # 55248) [39] ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The CaMV terminator was isolated from the PABE-7 plasmid (Addgene #115628) [28] and cloned into an entry vector via Gibson assembly.