Labshake search
Citations for Addgene :
2751 - 2800 of 3054 citations for 6 CHLORO 1 2 4 TRIAZOLO 4 3 B PYRIDAZINE 3 THIOL since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... and MHH-ES-1 were transduced with lentiviral Tet-pLKO-puro all-in-one vector system (plasmid #21915, Addgene) containing a puromycin-resistance cassette ...
-
bioRxiv - Neuroscience 2024Quote: ... we injected 0.3 μL AAVs encoding ChR2(H134R)-eYFP (titer = 1 x 1012 GC/ml, Addgene# 26973, RRID: Addgene_127090) into the layer 5 of medial prefrontal cortex (mPFC ...
-
bioRxiv - Biochemistry 2024Quote: The plasmid encoding full-length human dynein-1 was graciously provided by the Andrew Carter Lab (Addgene plasmid 11903). This plasmid featured the dynein-1 heavy chain fused to an N-terminus for the His-ZZ-SNAPf tag ...
-
bioRxiv - Cell Biology 2024Quote: ... the following cDNA sequences were cloned into pLKO.1 which was a gift from David Root (Addgene plasmid # 10878). by Genscript Corporation:
-
bioRxiv - Cancer Biology 2021Quote: The lentiviral constructs encoding mKO2-SLBP(18-126) and Clover-Geminin(1-110) were a gift from Michael Lin (Addgene plasmid # 83915 ...
-
bioRxiv - Cell Biology 2020Quote: ... and further subcloned into a CMV driven vector (pLenti CMV V5-LUC Blast (w567-1) was a gift from Eric Campeau (Addgene plasmid #21474 ...
-
bioRxiv - Cell Biology 2020Quote: Pairs of CRISPR guide RNA oligos (mouse Chmp5 single guide RNAs [sgRNAs] targeting GGCTCCGCCACCTAGCTTGA and GTTTCGCTTTTCCGAAGAAT on exon 1 respectively) were annealed and cloned into the BsmBI sites of lentiCRISPR V2-puro vector (plasmid 52961, Addgene). CRISPR lentiviral plasmids and lentiviral packaging plasmids (pMDLg/pRRE ...
-
bioRxiv - Immunology 2021Quote: ... a human RNH1-full coding sequence (ORIGEN RC 200082) insert was cloned into the entry vector pENTR4-GFP-C1 (W392-1, Addgene) and then recombined into the destination vector pLenti CMV Blast DEST (706-1 ...
-
bioRxiv - Immunology 2021Quote: RNH1-KO THP1 cells were infected with lentiviruses expressing RNH1 (pLenti CMV Blast GFP-RNH1) or the empty vector pLentiCMV-GFP-Blast (659-1, Addgene) as previously described (Papin et al. ...
-
bioRxiv - Microbiology 2019Quote: ... 2.18 μg of env-defective HIV-1 provirus containing GFP reporter was cotransfected with 0.31 μg pMD2.G VSV G plasmid (Addgene #12259). Simian immunodeficiency virus (SIV)−VLPs containing Vpx were produced by the transfection of 2.18 μg pSIV−Δpsi/Δenv/ΔVif/ΔVpr (Addgene #132928 ...
-
bioRxiv - Immunology 2019Quote: ... pMul1-FLAG and pAsc-Myc were subcloned into pLenti X2 Hygro DEST (a gift from Eric Campeau and Paul Kaufman, w17-1, #17295, Addgene) and transfected into HEK293T cells together with the helper plasmid (psPAX2 ...
-
bioRxiv - Microbiology 2019Quote: ... and cloned into EcoRV-cut pLenti CMV Puro DEST (w118-1) (gift from Eric Campeau & Paul Kaufman; Addgene plasmid # 17452) using NEBuilder® HiFi DNA Assembly Master Mix (New England BioLabs) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... to specifically target TP53 translation stop site and it was cloned into pX330-U6-Chimeric_BB-CBh-hSpCas9-hGem (1/110) (Addgene #71707) according to the protocol of Ran et al.51 ...
-
bioRxiv - Neuroscience 2020Quote: ... Whole-cell patch-clamp recordings were also performed for functional evaluation of Cl− microdomains (Figure 1) on organotypic slices of DLX-Cre mice which were transfected on the day of slicing with tdTomato virus (Addgene-AAV9-CAG-FLEX-tdTomato ...
-
bioRxiv - Biochemistry 2020Quote: ... H-HCF-1) and full length human THAP11 cDNA with carboxy-terminal FLAG tag (Plasmid #28020; F-THAP11) were obtained from Addgene. Vectors containing full length human THAP1 cDNA with carboxy-terminal 1X FLAG tag (THAP1-F ...
-
bioRxiv - Biophysics 2020Quote: ... as per the manufacturer’s instructions into pLenti CMV Hygro DEST (W117-1, a gift from Dr. Eric Campeau & Dr. Paul Kaufman, Addgene #17454) to create the final vector which was sequence verified by Sanger sequencing (Australian Genome Research Facility) ...
-
bioRxiv - Cancer Biology 2020Quote: ... we designed single guide RNAs specifically targeting exon 1 of the mouse Bmal1 gene and subcloned it into the PX459 vector (Addgene) to obtain the PX459-Bmal1 plasmid ...
-
bioRxiv - Cancer Biology 2019Quote: ... was prepared by introducing four silent mutations into the sequence targeted by shNRF2 #1 in pEN_TT 3xFLAG-NRF2 (Addgene #136527). Site-directed mutagenesis was performed with the QuikChange II XL kit (Agilent).
-
bioRxiv - Cell Biology 2021Quote: ... and pLKO.1 puro-based plasmid harboring the designed shRNA (pCMV-VSV-G and pLKO.1 puro were a gift from Bob Weinberg, Addgene plasmid #8454 ...
-
bioRxiv - Neuroscience 2020Quote: PV-Cre and SST-Cre slices were transfected in three different configurations: 1) 2.2 μL of ChETA (pAAV9-Ef1a-DIO-ChETA-EYFP Addgene#: 26968) and 1 μL of LSL-tdTomato (Addgene# ...
-
bioRxiv - Molecular Biology 2020Quote: A pET28a vector with sub-cloned cDNA of Hsp53-(1-73) (72R) and the N-terminal His-tag was procured from Addgene, (plasmid #62082) ...
-
bioRxiv - Microbiology 2021Quote: ... 10 μg of pEA216-1 was then co-transfected with 5 μg of the pCMVΔR8.2 helper plasmid (Addgene Plasmid #122263) and 1 μg of pHEF-VSV-G into 70% confluent monolayers of 293T cells in a 10 cm dish using polyethylenimine (Polysciences Inc ...
-
bioRxiv - Neuroscience 2020Quote: ... to label hyaluronic acid-based ECM we designed AAV expression vector carrying link protein hyaluronan and proteoglycan link protein 1 (HAPLN1, Gene ID: 12950) fused with mScarlet subcloned from the plasmid pCytERM_mScarlet_N1 (Addgene plasmid # 85066). Clones were verified by sequencing analysis and used for the production of adeno-associated particles as described previously (Mitlöhner et al ...
-
bioRxiv - Cell Biology 2020Quote: Huwe1 stable knockdown: The same targeting sequences as for siRNA studies were cloned to pLKO.1 puro plasmid (Addgene 8453). As control ...
-
bioRxiv - Cancer Biology 2021Quote: ... Luciferase was introduced into pediatric brain tumor cell lines using lentiviral plasmids: pLenti CMV Puro LUC (w168-1) was a gift from Eric Campeau & Paul Kaufman(45) (Addgene plasmid # 17477 ...
-
bioRxiv - Cell Biology 2022Quote: ... RPE-1 TUB-mRFP cells were generated in our lab by transduction with lentiviral vectors containing tubulin m-RFP (Addgene). HEK293T cells at a 50-70% confluence were co-transfected with lentiviral packaging vectors (16.6 μg of Pax2 ...
-
bioRxiv - Biochemistry 2022Quote: ... full-length FUS with an N-terminal histidine tag and maltose-binding protein fusion (pTHMT FUS 1-526, AddGene #98651), and FUS RGG3 with N-terminal histidine tag and MBP fusion (pTHMT FUS RGG3 (453-507) ...
-
bioRxiv - Cell Biology 2022Quote: ... organoid fragments were washed and resuspended in Opti-MEM supplemented with Y-27632 (10 µM) and 10µg of pSPgRNA plasmid together with the frame selector plasmid pCAS9-mCherry-Frame +1 (Addgene #66940) and the mNEON targeting plasmid (a kind gift from V ...
-
bioRxiv - Microbiology 2022Quote: Retrovirus particles for transduction and stable cell generation were produced in HNE-1 cells following JetPrime transfection of expression plasmids (pBabe neo, pBabe-HA-LMP1 neo) and packaging plasmids pMD2.G (Addgene; number 12259 ...
-
bioRxiv - Cell Biology 2022Quote: A His-tagged mouse Capping Protein (F-actin-capping protein subunit alpha-1 and F-actin-capping protein subunit beta) plasmid was obtained from Addgene as described above (Plasmid #89950) ...
-
bioRxiv - Neuroscience 2021Quote: Other viruses used in the paper: AAV2/1-hSyn-hChR2(H134R)-EYFP was a gift from Karl Deisseroth (Addgene #26973); AAV2/1-hSyn-hM3D(Gq)-mCherry was a gift from Bryan Roth (Addgene #50474) ...
-
bioRxiv - Neuroscience 2020Quote: Full-length Susd4 mouse gene was cloned into the mammalian expression vector pEGFP-N1 (Addgene, Massachusetts, USA, Cat#6085-1) to express a SUSD4-GFP fusion construct under the control of the CMV promoter (pSUSD4-GFP) ...
-
bioRxiv - Cell Biology 2021Quote: ... Exogenous cells - MDCK cells were mosaically transfected using a CMV GFP vector (pLenti CMV GFP Blast (659-1) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid #17445 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The plasmid 6His-MBP-TEV-huLbCpf1 (plasmid # 90096) (see Figure.1 and Supplementary M3 in the Supplement Data) was purchased from Addgene. After extracted from amplified strains ...
-
bioRxiv - Cancer Biology 2020Quote: Primary dMMR mouse or human organoids were generated using lentiviral transduction as described previously.25,30 Lentivirus was prepared as previously described using the pLKO.1 system (Addgene #10878) and containing the shRNA sequences in Supplementary Table 1.24 Lentivirus was concentrated 100X by ultracentrifugation ...
-
bioRxiv - Plant Biology 2022Quote: ... The first step involved the cloning of the tobacco sgRNA expression vectors (pYPQ131c, pYPQ132c, and pYPQ133c (Addgene, USA; Table 1) that contained the sgRNAs as inserts ...
-
bioRxiv - Immunology 2022Quote: ... annealed oligos were diluted 1:20 in molecular grade H2O and then ligated into Esp3I-digested pLentiCRISPR V2.0 (Addgene #52961). Ligation reactions were then transformed into Top10 competent E ...
-
bioRxiv - Cancer Biology 2019Quote: ... the HFF-1 cells were lentivirally transduced with GFP-H2B nuclear marker using the PGK-H2BeGFP system as described by Addgene and selected by flow sorting for GFP positive cells.
-
bioRxiv - Cell Biology 2019Quote: ... Annealed oligos were diluted 1/40 and 1 μl of insert was ligated into 10 ng of digested vector (pU6-sgRNA EF1Alpha-puro-T2A-BFP, Addgene plasmid #60955 digested with BstXI and Blpl ...
-
bioRxiv - Cell Biology 2019Quote: ... IRES DNA and mCherry cDNA were prepared by PCR using pEYFP SUMO-1 plasmid (from Mary Dasso: Addgene plasmid #13380), pWPI plasmid (from Didier Trono ...
-
bioRxiv - Microbiology 2020Quote: ... or human ACE2 ectodomain (containing a C-terminal His tag) were made according to the E and F sections of the pLKO.1 Protocol from Addgene (http://www.addgene.org/protocols/plko/) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and plasmids were obtained from Open Biosystems or cloned using pLKO.1-TRC (a gift from Dr. David Root (Addgene # 10878; http://n2t.net/addgene:10878; RRID: Addgene 10878)) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and plasmids were obtained from Open Biosystems or cloned using pLKO.1-TRC (a gift from Dr. David Root (Addgene # 10878 ...
-
bioRxiv - Neuroscience 2021Quote: ... mDlx-Azurite was generated by replacing EGFP with Azurite from the pAAV-mDlx-GFP-Fishell-1 plasmid (Addgene number: 83900). Generation of pORANGE Btbd11 constructs were generated using the pORANGE Cloning template vector (Addgene number ...
-
bioRxiv - Molecular Biology 2020Quote: ... The four guide sequences for the Ascl1 locus (see Table 1) were taken from (Black et al., 2016) and cloned into pmU6-gRNA (Addgene: 53187 ...
-
bioRxiv - Neuroscience 2020Quote: ... CMV-PercevalHR (1×1010 TU/mL, produced at the University of North Carolina Vector Core Facility based on plasmid # 49083, Addgene, kindly provided by Dr ...
-
bioRxiv - Microbiology 2021Quote: ... and pCT-CD63-GFP (SBI, CYTO120-PA-1) plasmids were transfected in HEK293T cells with the packaging plasmids pMD2.G (Addgene; number 12259 ...
-
bioRxiv - Neuroscience 2020Quote: To express oChIEF-mCitrine in pOXR1-Cre mice, a recombinant adeno-associated virus (rAAV, serotype 1, 4.8×1013 VC/ml titer) expressing FLEXed oChIEF-mCitrine (Addgene #50973) was package by Vector Biolabs (Malvern ...
-
bioRxiv - Immunology 2021Quote: ... par-5 and his-1 cDNA were subcloned into pCE-BiFC-VN173 and pCE-BiFC-VC155 plasmids (Addgene, Cambridge, MA), which contain the heat shock promoter Phsp-16.41 ...
-
bioRxiv - Cell Biology 2021Quote: ... The constitutively active form of kinesin-1 (human KIF5B, K560) was cloned by PCR from pet17-K560-GFP_His (Addgene, 15219) into pEGFP-N1 vector using EcoRI primer (104-5p EcoRI-K560 ...