Labshake search
Citations for Addgene :
2601 - 2650 of 2722 citations for Monoisononyl Phthalate 100 Ug Ml In Mtbe Ring 1 2 13C2 Dicarboxyl 13C2 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: Individual single-guide RNAs (sgRNAs) (sgBTN3A2 #1: TGTTCTCTCCCTTGGCGTTGCTCCACTGTA; sgBTN3A2 #3: ATCATGAGAGGCGGCTCCGGGGAGGGTGTATC) targeting the candidate gene were cloned into linearized lentiCRISPRv2 (#52961, Addgene, USA). Lipofectamine™ 3000 transfection reagent in Opti-MEM medium was used to co-transfect HEK293T cells with psPAX2 (#12260 ...
-
bioRxiv - Cancer Biology 2024Quote: ... ALKBH5 shRNA was generated by ligation of oligonucleotides into the AgeI and EcoRI restriction sites of pLKO.1 (Addgene plasmid #8453). Lentiviral-shRNA particles were generated by transfecting HEK 293T cells with 12 μg of pLJM1 vector containing the shRNA ...
-
bioRxiv - Biochemistry 2024Quote: ... pEGFP-C1-tagged plasmids containing the exon 1 of HTT with 23 CAG repeats (GFP-Q23: wild-type HTT. Addgene, #40261) or 74 CAG repeats (GFP-Q74 ...
-
bioRxiv - Molecular Biology 2023Quote: Two oligos H3F3AN-1-73F CACCGTCAATGCTGGTAGGTAAGTA and H3F3AN-1-73R AAACTACTTACCTACCAGCATTGAC containing gRNA sequence were annealed and inserted into pSpCas9-2A-Puro vector (PX459, Addgene # 62988), digested with BbsI-HF enzyme (NEB ...
-
bioRxiv - Cell Biology 2022Quote: ... replication-deficient lentiviruses were produced and titrated as described by co-transfection of the resulting constructs in HEK-293T cells with the HIV-1 packaging plasmid psPAX2 (Addgene #12260) and the plasmid pMD2.G (Addgene #12259 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Microdomain targeting was accomplished using N-terminal fusions of tags to the matrix using 2xCOX8A (tag corresponds to Cox8A N-terminal residues 1-25, from Addgene 136470), the IMS using SMAC (residues 1-59 ...
-
bioRxiv - Neuroscience 2023Quote: ... Adeno-associated virus for expressing GcaMP7f or 8f under the synapsin-1 promoter (AAV1-syn-jGCaMP7f-WPRE; Addgene 104488; AAV1-syn-jGCaMP7f-WPRE, Addgene 162376) was injected into the wS1 at depths of 250 μm and 120 μm below the dura and at a rate of 1 nL/sec (50 nL total per location) ...
-
bioRxiv - Developmental Biology 2023Quote: ... the three sgRNA expression cassettes were subcloned one by one from the three lentiGuide-Puro plasmids into a modified pLKO.1-TRC plasmid (additional multiple cloning site BclI-EsrGI-MluI-NheI-PstI-SalI-XbaI-XmaI was inserted between the original PpuMI and EcoRI sites in the pLKO.1-TRC plasmid (Addgene # 10878)) to make tandem sgRNA expression cassettes in the same lentiviral vector.
-
bioRxiv - Cell Biology 2023Quote: ... Plasmids that express trak-1 and miro-1 sgRNAs were made by swapping the N19 sequence of the unc-119 sgRNA from the preexisting plasmid (Addgene #46169) (Friedland et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... Briefly we expressed GCaMP6s41 or JrGeco1a42 by microinjection of AAV2/1-hSyn-GCaMP6s/JrGeco1a-WPRE-SV40 (University of Pennsylvania Vector Core or Addgene®) into the visual cortex 1- 4 weeks before imaging experiments ...
-
bioRxiv - Neuroscience 2023Quote: We used AAV-9-syn-GCaMP6s vector with synapsin promoter (pGP-AAV-syn-GCaMP6s-WPRE.4.641 at a titre of 1x1013 GC·ml-1, Addgene, Watertown, MA, USA), and therefore it transduced neurons showing higher tropism for the AAV 2/9 subtype ...
-
bioRxiv - Plant Biology 2023Quote: ... These Level 0 promoter parts were used in in one-step digestion-ligation reactions with the Level 1 Loop pCk1 (Addgene #136695) backbones together with parts containing LucN (pEPYC0CM0133 ...
-
bioRxiv - Genomics 2023Quote: Two different versions of the Brunello library were used – a “1 vector system” (backbone expresses both Cas9 and the sgRNA library – Addgene #73179) and a “2 vector system” (backbone expresses only the sgRNA library – Addgene #73178) ...
-
bioRxiv - Cancer Biology 2023Quote: The lentivirus shRNA plasmids targeting mouse RelA and Pkci were generated by cloning annealed oligos into AgeI and EcoRI sites of pLKO.1-hygro-ctrl plasmid (Addgene #24150). Following target sequences and oligos were utilized ...
-
bioRxiv - Cell Biology 2022Quote: ... the PCR-amplified fragment of pie-1p::gfp::PH::pie-1 3’UTR was inserted into pCFJ1662 (a gift from Erik Jorgensen, Addgene #51482). Plasmid mixtures containing pCFJ1662_PH ...
-
bioRxiv - Developmental Biology 2023Quote: ... shortened to 19 bp length and flanked with BbsI overhangs. Corresponding oligonucleotides (Suppl. Table 1) were inserted into BbsI-digested pX330-U6- Chimeric_BB-CBh-hSpCas9 (obtained from Addgene, plasmid #42230) 35 to generate pX330- Ep400-Ex15 and px330-Kat5-Ex8 ...
-
bioRxiv - Cell Biology 2023Quote: ... CFP-GAI-MTM1 was made by inserting MTM1 from mCherry-FKBP-MTM1 after GAI in CFP-GAI(1-92) (gift from Takanari Inoue, Addgene # 37307). LysoYFP-GID1 was made by inserting Lyso from LysoGFP-Sac1 before YFP in YFP-GID1 (gift from Takanari Inoue ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/1-DIO-EF1α-mVenus-biPAC (Boston Children’s Hospital Vector Core) and AAV1-Syn-Flex-NES-jRCaMP1a-WPRE-SV40 (Addgene 100848-AAV1) were unilaterally injected into the PVH of MC4R-2A-Cre mice (1:1 mixture ...
-
bioRxiv - Developmental Biology 2023Quote: 2.5×105 hESCs (AIC-hESCs or AIC-N hESCs) were electroporated with 1 μg of donor plasmid AAVS1-CAG-hrGFP (Addgene, #52344) or AAVS1-Pur-CAG-mCherry (Addgene ...
-
bioRxiv - Plant Biology 2023Quote: ... the coding sequence of each transcription factor and the YFP coding sequence were cloned into pUAP4 in one-step restriction-ligation reactions to create Level 0 parts (with stop codons) that were subsequently assembled into the level 1 Loop acceptor (pCk2; Addgene #136696) in one-step restriction-ligation reactions with a CaMV35sP-ΩTMV (pICH51277 ...
-
bioRxiv - Plant Biology 2023Quote: Plant codon-optimized HypaCAS9 expressed under the EC1.1 promoter was generated by mutagenesis of the EC1pro:CAS9 sequence from the pHEE401E plasmid (Wang et al., 2015; Addgene Plasmid #71287). Two fragments were amplified by PCR with oligonucleotide primers harboring the hypaCas9 mutations described in Chen et al ...
-
bioRxiv - Cancer Biology 2023Quote: Engineering of Luc-tagged HCC1954 cells (HCC1954-Luc) and tumour implantation: the pLenti CMV Puro LUC (w168-1) was purchased from Addgene (#17477) and used in all in vivo experiments ...
-
bioRxiv - Molecular Biology 2023Quote: ... containing 10% FBS and 1% penicillin-streptomycin, and equal amounts of plasmids (250 ng of each: luciferase reporter, actin-GAL4 (Addgene #24344), one dCas9-Rb constructs ...
-
bioRxiv - Immunology 2024Quote: Stable Cas9 expression was established in human B-cell lines (WSU-FSCCL, HBL-1 and SUDHL5) using lentiviral transduction of lentiCas9-Blast (Addgene #52962). Cells were incubated with 10µg/ml polybrene (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2024Quote: ... 5% FBS,0.01% Sodium Pyruvate) were transfected according to manufacturer instructions using Lipofectamine 2000 with plasmids carrying HIV-1 Gag/Pol (pMDLg/pRRE Addgene: 12251), HIV-1 Rev (pRSV-Rev Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... Site-directed integration into attP sites was achieved by co-injection of an attB-containing vector (400 ng µl-1) and pBS130 (encoding ΦC31 integrase under control of a heat shock promoter (Addgene #26290) (Gohl et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... mScarlet-i-PLEKHA5WW was made by inserting the cDNA sequence encoding the tandem WW domain (residue 1-105) into the CMV-mScarlet-i-C1 vector (Addgene 85044) using BamHI and SalI ...
-
bioRxiv - Cancer Biology 2024Quote: WNK1 depletion by CRISPR-Cas9 editing was done by using two independent gRNAs targeting Exon-1 (5’-CGCCGACGCTGTGACCGGC-3’) and Exon-4 (5’-ACTTACACTGGTCACGCGA-3’) cloned into pKLV2-U6gRNA5(BbsI)-PGKpuro2ABFP-W backbone vector (Addgene #67974). TET-ON-Cas9 expressing cells were infected and BFP-positive cell FACS sorted ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 × 106 cells were plated in 60 mm dishes for 24 hours followed by transfection with m6A-Tracer GFP (AddGene, 139403) and DAM-lamin B1 (AddGene ...
-
bioRxiv - Neuroscience 2024Quote: ... a plasmid with the synapsin-1 promoter that controls the expression of the biosensor GCaMP6 and fused to the red fluorochrome mRuby2 (Addgene, # 50942); and hSyn-HyPer ...
-
bioRxiv - Molecular Biology 2024Quote: ... the sgRNA coding sequence (Supplementary Table 1) was cloned into pX459 V2.0 vector (a gift from Feng Zhang; Addgene plasmid 62988)63 ...
-
bioRxiv - Molecular Biology 2024Quote: ... the rtTA3 gene fused to the blasticidin resistant marker (BlastR) was adapted from the pLenti CMV rtTA3 Blast (w756-1) plasmid (Addgene, 26429).
-
bioRxiv - Developmental Biology 2024Quote: ... Individual sgRNAs targeting sites 1-4 of the SABER array were cloned into 4 separate U6x:sgRNA plasmids (Addgene plasmids 64245-64248) as described previously52 ...
-
bioRxiv - Cancer Biology 2021Quote: ... A 370 bp fragment of genomic DNA containing miRNA miR-34c was cloned into the Xho I and Mlu I restriction sites of the pLKO.1 vector (Addgene plasmid #52920) to express miR-34c (32) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1-cell stage embryos were injected with a 1 nl mix of approximately 56-60 pg sgRNA and 190 pg cas9 mRNA (Addgene plasmid #47322). Mosaic embryos were raised to adulthood and crossed with Tupel Long fin (TL ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... of a virus driving expression of membrane-targeted mCherry under control of the GFAP promoter (AAV5/GFAP-hM3dq-mCherry, University of Zurich, Figs. 1-5 or AAV5/GfaABC1D-Lck-GFP, Addgene, Fig. 6) in the NAcore (+1.5mm AP ...
-
Rab35 Governs Apicobasal Polarity Through Regulation of Actin Dynamics During Sprouting AngiogenesisbioRxiv - Developmental Biology 2022Quote: ... The destination vector used in this study was pLenti CMV Neo DEST (705-1) (gift from Eric Campeau & Paul Kaufman; Addgene plasmid #17392). Once validated ...
-
bioRxiv - Cell Biology 2019Quote: ... containing the FOXJ1 targeting sgRNA sequence 5’-GGGCCTTCTTGTAAGAGGCC-3’ or the CCDC40 targeting sgRNA sequence 5’-CTCCTCGTTGGCGGCTGCGCAGG-3’ with 1 μg of MBX plasmid (gift from Linzhao Cheng, Addgene plasmid #64122) and 1 μg of homemade donor plasmid pUC19_FOXJ1_mCherry_cNEO for the FOXJ1_mCherry tagging project were mixed with 4 μL of Lipofectamine and left at room temperature for 10 min to form complexes ...
-
bioRxiv - Cancer Biology 2020Quote: ... To generate inducible CRISPR-Cas9 GFPT2 KO cell lines, parental cells (H460, H157, Calu-1) were first infected by pCW-Cas9 plasmid (Addgene plasmid #50661), sorted by puromycin selection ...
-
bioRxiv - Cell Biology 2020Quote: ... and subcloned into pcDNA3.1-MCSBirA(R118G)-HA vector (a gift from Kyle Roux, Addgene plasmid #36047; http://n2t.net/addgene:36047; RRID:Addgene_36047, (Roux et al, 2012)) ...
-
bioRxiv - Cancer Biology 2021Quote: ... KRT14 mouse and Human ShRNA sequence were cloned in the 3rd generation transfer plasmid pLKO.1 TRC cloning vector (Addgene cat # 10878) between unique AgeI and EcoRI restriction sites downstream of the U6 promoter ...
-
bioRxiv - Neuroscience 2020Quote: ... the promoter was substituted by mDlx enhancer sequence from pAAV-mDlx-GFP-Fishell-1 (a gift from Gordon Fishell, Addgene plasmid # 83900) and cDNA encoding mCherry was further inserted into multicloning site 21 ...
-
bioRxiv - Plant Biology 2021Quote: ... was cloned together with pICH47802-p35S::ER:tdTOM::tNOS selection marker (position 1) in the final plant expression vector pAGM4673 (Addgene, catalog number: 48014). For simultaneous live imaging ...
-
bioRxiv - Neuroscience 2020Quote: ... each given at a total volume of 0.8 μl per hemisphere: 1) inhibitory Gi DREADD (AAV5-hSyn-hM4Di-mCherry; UNC Vector Core; n = 5; AAV8-hSyn-hM4Di-mCherry; Addgene; n = 5); excitatory Gq DREADD (AAV8-hSyn-hM3Gq-mCherry ...
-
bioRxiv - Genomics 2021Quote: ... 100 ng of a synthetic gblock encoding the the HS-CRM8-TTRmin module38 upstream of dsRed (Integrated DNA Technologies) and 1 μg of sgOpti (gift from Eric Lander and David Sabatini, Addgene plasmid #85681)39 ...
-
bioRxiv - Cell Biology 2021Quote: ... A control cell line was generated by infecting U2OS cells stably expressing a non-targeting sgRNA (above) with the lentivirus vector pLKO.1-blast-Scramble (Addgene, cat# 26701) expressing a non-targeting shRNA sequence and selected with 15µg/ml blasticidin for 7 days ...
-
bioRxiv - Cell Biology 2020Quote: WT and JMS hiPSCs were transduced with lentiviruses encloding for the non-specific control short-hairpin RNA (shControl; pLKO.1 puro (Addgene ID: 8453)) or the p53 targeting shRNA (shp53 pLKO.1 puro shRNA (Addgene ID ...
-
bioRxiv - Biochemistry 2022Quote: ... and CstF77 (Uniprot Q12996-1) were cloned into ligation-independent cloning (LIC) expression vectors 1B (gift from Scott Gradia, Addgene plasmid #29653), 1M (Addgene plasmid #29656) ...
-
bioRxiv - Neuroscience 2022Quote: ... GAD2-IRES-Cre mice were injected in the ZI with a 5:1 mix of AAV2/5-hSynapsin1-Flex-axon-GCaMP6s (Addgene, #112010-AAV5) and AAV2/9-FLEX-tdTomato (Addgene ...
-
High-performance GPCR optogenetics based on molecular properties of animal opsins, MosOpn3 and LamPPbioRxiv - Biochemistry 2022Quote: ... The vector backbone containing SL1 and GFP was obtained by digestion of the plasmid [pEM1 = flp-21::LoxPStopLoxP::npr-1 SL2 GFP] (Addgene plasmid # 24033)65 with NotI and KpnI ...