Labshake search
Citations for Addgene :
2601 - 2650 of 2891 citations for Human Immunodeficiency Virus GP120 Protein HIV 1 Clade A KNH1144 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... were co-transfected with either mKO2-hCdt1(30/120)/pCSII-EF or mAG-hGeminin(1/110)/pCSII-EF) and 2nd generation viral packaging plasmids VSV.G (Addgene #14888) and psPAX2 (Addgene #12260) ...
-
Importin α/β Promote Kif18B Microtubule Association to Spatially Control Microtubule DestabilizationbioRxiv - Cell Biology 2022Quote: ... or pLOVE-EGFP-Kif18B-siRNAR-EBBD plasmids with 1 μmol each of the packaging plasmids dRT-pMDLg/pRRE (Addgene #60488), pRSV-Rev (Addgene #12253) ...
-
bioRxiv - Genomics 2022Quote: pNLZ11 (Pfib-1::NLS::scFv::sfGFP::NLS::tbb-2 3′UTR) construct has the pCFJ210 vector backbone (Addgene plasmid # 19329). A codon-optimized scFv::sfGFP fragment [42] was ordered from IDT ...
-
bioRxiv - Cell Biology 2022Quote: The sgRNA oligomers for SLC25A46 targeting exon 1 and 3 were annealed and inserted into plasmid pSpCas9(BB)-2A-Puro (PX459) V2.0 from Addgene (62988) via combined ligation (T7 ligase NEB).
-
bioRxiv - Genomics 2022Quote: cDNA encoding the short isoform of ETS-1 (p54) was cloned into pENTR vector and then into the destination vector MSCV-IRES-Thy1.1 DEST (Addgene: 17442) using Gateway cloning strategy (Gateway Clonase II ...
-
bioRxiv - Neuroscience 2022Quote: ... and AAV2-hSyn-mCherry (UNC vector core) (Figures 2, 6, & 7; Figure 2 – Figure supplement 1) or retrograde AAV-hSyn-DIO-eGFP (Addgene) and retrograde AAV-hSyn-mCherry (Addgene ...
-
bioRxiv - Molecular Biology 2022Quote: ... Virus was generated by plating 3.5×104 COS1 cells per well in a 6 well plate and transfecting them on the 2nd day with 1 ug total plasmid per well at a 5:3:2 ratio of lentiCRISPR:psPAX2(Addgene #12260):pMD2.G(Addgene#12259 ...
-
bioRxiv - Microbiology 2023Quote: ... and lentiviral particles expressing human TMPRSS2 (selection with 1 mg/ml G418). The TMPRSS2 (cat. 145843) and ACE2 (cat. 145839) lentiviral DNA clones (23) were purchased from Addgene and transfected into HEK293T cells together with pSPAX2 (Addgene ...
-
bioRxiv - Neuroscience 2022Quote: ... 800-1000 nL of a AAV5-hSyn-dLight1.2 vector (~1 × 1013 viral genomes/mL, obtained from Addgene; catalog #AAV5-111068) was delivered into the LNAc (antero-posterior ...
-
bioRxiv - Physiology 2022Quote: ... (Gagoski et al., 2016) or the rhodopsin-muscarinic receptor type 1 chimera (opto-M1R) (Morri et al., 2018) were purchased from Addgene (plasmids 67130 and 106069 respectively ...
-
bioRxiv - Physiology 2024Quote: cDNA of the canonical NR4A3 transcript (NR4A3-203; NM_006981.4) was synthesised into a modified pLenti CMV Puro DEST (w118-1) vector (Addgene plasmid #17452) by GENEWIZ (Azenta Life Science ...
-
bioRxiv - Molecular Biology 2024Quote: ... Annealing reactions were diluted 1:10 with water and then 1µL was used to ligate into 100ng of BsmBI digested pLentiGuidePuro vector (Addgene #52963) in 1x T4 DNA Ligase Buffer ...
-
bioRxiv - Neuroscience 2024Quote: ... rats received a bilateral prelimbic (PrL; AP: +2.8, ML: +/-0.6, DV: -3.8) infusion of AAV2.CamKII::hChR2(H134R)-EYFP (Addgene, titer: ∼1×1013) and a bilateral infusion of either AAV2.CMV::nNOS-shRNA-EGFP or AAV2.CMV::luciferase-shRNA-EGFP combined with an AAV2.hsyn::DIO-mCherry (Addgene ...
-
bioRxiv - Molecular Biology 2024Quote: ... Two gRNAs targeting Exon 1 (targeting sequence GGGCGCGCTACCTGTCTCCG) and Exon 10 (targeting sequence GAACTGGACTTTGAAAGAGG) were cloned in BPK1520 (Addgene #65777) and transfected with Amaxa Nucleofector II together with BPK4410 ...
-
bioRxiv - Cancer Biology 2024Quote: ... sgRNA oligonucleotides purchased from IDT were annealed and ligated in the BbsI restriction site of pX330A-1×2 (Addgene, #58766) plasmid to make pX330A-1x2-cNAT10 vector ...
-
bioRxiv - Cell Biology 2024Quote: ... we received plasmids encoding WT SARS-CoV-2 SP (Wuhan-Hu-1) and its receptor binding domain (RBD) from Addgene under a Material Transfer Agreement ...
-
bioRxiv - Immunology 2024Quote: ... One microliter of 1:100 diluted product was used for golden gate cloning into lentiCRISPR v2-Puro (Addgene plasmid #52961) using 11 cycles of 5 minutes T4 ligase ligation at 16 °C and 5 minutes of BsmbI digestion at 37 °C ...
-
bioRxiv - Biochemistry 2023Quote: The coding sequence for amino acids 1-110 of GCP2 were PCR amplified from pACEBac1-gamma-TuSC (a gift from Tarun Kapoor (Addgene plasmid # 178079 ...
-
Ribonuclease Inhibitor and Angiogenin collaboratively regulate cell-type-specific global translationbioRxiv - Biochemistry 2024Quote: RNH1-KO K562 cells were infected with lentiviruses expressing ANG (pLenti CMV Blast GFP-ANG) or the empty vector pLenti CMV Blast DEST (706-1, Addgene) as previously described 52 ...
-
Ribonuclease Inhibitor and Angiogenin collaboratively regulate cell-type-specific global translationbioRxiv - Biochemistry 2024Quote: ... the human Angiogenin (ANG) full coding sequence (ORIGEN RC 208874) was cloned into the entry vector pENTR4-GFP-C1 (W392-1, Addgene) and then recombined into the destination vector pLenti CMV Blast DEST (706-1 ...
-
bioRxiv - Cancer Biology 2024Quote: ... This fragment was subcloned by restriction (BamHI and XhoI) and ligation into the lenti-vector expression backbone plasmid pLenti-CMV-Blast-empty-(w263-1) (Addgene). Sequence integrity was validated with Sanger sequencing ...
-
bioRxiv - Neuroscience 2023Quote: ... injections of rAAV2-retro-Cre (produced by Salk Vector Core or Vigene, 2×1012 to 1×1013 viral genomes/ml, produced with capsid from Addgene plasmid #81070 packaging pAAV-EF1a-Cre from Addgene plasmid #55636 ...
-
bioRxiv - Neuroscience 2023Quote: ... titer ≥ 1×1013 vg/mL) and pAAV-CAG-GFP (titer ≥ 7×1012 vg/mL) viral preps were purchased from Addgene (Addegene viral prep # ...
-
bioRxiv - Neuroscience 2023Quote: ... Cortical injections to adult C57BL/6J mice additionally included a 1:300 dilution of rAAVretro-hSyn-Cre (Addgene #105553-AAVrg) to induce expression of Voltron2-ST and a 1:150 dilution of AAV9-hSyn-Cheriff-EGFP (Addgene plasmid #51697 ...
-
bioRxiv - Plant Biology 2023Quote: The full-length or 3TPR-truncated cDNA sequence of SPY was amplified from Arabidopsis cDNA with appropriate primers (listed in Supplemental Table 1) and cloned into the pET28sumo vector (Addgene?), which adds a 6xHis-SUMO tag to the N-terminus of the protein of interest ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1% Pen/Strep and 0,5mg/ml Geneticin) by transient transfection of transfer vector 2nd generation packaging plasmid-psPAX2 (Addgene #12259) and envelope vector-pMD2 (Addgene #12260 ...
-
bioRxiv - Microbiology 2023Quote: ... Both rIIB and rexAB were cloned under the IPTG-inducible PLlacO-1 promoter into the vector pBbA6c-RFP50 (Addgene 35290) using NEBuilder HiFi DNA Assembly ...
-
bioRxiv - Cell Biology 2022Quote: ... plasmids from the step 1 were cloned into pLV GG hUbC-EGFP (84034, Addgene; dsRED was replaced with EGFP from 1168, Addgene) by Golden gate assembly method.
-
bioRxiv - Cell Biology 2023Quote: ... vector while the FBXL4 sgRNA-1 (5’-TTGGTCAGAGAGACCTACGA-3’) and FBXL4 sgRNA-2 (5’-TGGACTACCTCTGCATTGAG-3’) plasmids were cloned into the pLenti-sgRNA (71409; Addgene) vector ...
-
bioRxiv - Genomics 2023Quote: ... The pLV-Myf5Promoter-GFP plasmid was built by insertion of two sequences in a pLKO.1 plasmid backbone (Addgene #10878). The Myf5-promoter sequence was added at NdeI and KpeI cutting sites and the CRE-GFP sequence was added at SpeI and XhoI restriction sites using a T4 DNA ligase (NEB #M0202L) ...
-
bioRxiv - Cell Biology 2022Quote: ... MLKL gene and its truncated version MLKL(1-182) were amplified by standard PCR from pRetrX-TRE3G-hMLKL-Venus (Addgene_106078) using primers MLKL_Fw and MLKL_Rv for the first ...
-
bioRxiv - Cancer Biology 2023Quote: Plasmids for CRISPR/Cas9-mediated Ilk knockout were generated by cloning oligonucleotides encoding 2 sgRNAs targeting the Ilk gene (1) between the BbsI sites of the eSpCas9(1.1) plasmid76 (a gift from Feng Zhang; Addgene; #71814). For Ilk re-expression ...
-
bioRxiv - Genomics 2023Quote: ... RRID:Addgene_85451)20. We replaced the hU6-sgRNA cassette with the mU6-sgRNA cassette from pMK1334 (ref. 1) (Addgene plasmid #127965, RRID:Addgene_127965) by restriction cloning between sites MluI and XbaI ...
-
bioRxiv - Biochemistry 2023Quote: ... 8 µg psPAX2 packaging plasmid DNA and 1 µg pMD2.G envelope plasmid DNA (both gifts from Didier Trono, Addgene plasmid no ...
-
bioRxiv - Cancer Biology 2023Quote: ... shRNA 2 (shYAP1 #2) or scramble shRNA (shNC) were inserted into pLKO.1-TRC Cloning Vector (Addgene, 10878, RRID: Addgene_10878) following the manufacturer’s protocol and sequenced ...
-
bioRxiv - Biophysics 2023Quote: Fusion constructs with pTREtight2 vectors were co-transfected with reverse tetracycline-controlled transactivator 3 (pLenti CMV rtTA3 Hygro (w785-1)) plasmid (Addgene) in the presence of doxycycline (Clontech) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Sequences encoding Ifi205 ORF and Ifi205K364ER299E ORF were amplified by PCR then subcloned between the BamHI and EcoRI restriction sites of pGEX-6P-1(Addgene). Ifi205 proteins were expressed as GST-Ifi205-FLAG-fusions in the E ...
-
bioRxiv - Neuroscience 2023Quote: ... two gRNAs designed to target exon 1 of ZNF91 [24] were cloned and inserted into pX330-SpCas9-HF1 (Addgene #108301). In addition to the gRNAs ...
-
bioRxiv - Neuroscience 2023Quote: ... of adeno-associated viruses encoding the genetically-encoded calcium indicator GCaMP6s and mRuby2 as a structural marker under the control of the synapsin 1 promoter (pAAV-hSyn1-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA, cat. no. 50942-AAV1, Addgene) and slowly lowered to ∼350 µm below the surface of the exposed brain with an HO-10 hydraulic micromanipulator (Narishige) ...
-
bioRxiv - Cancer Biology 2023Quote: ... shRNA 2 (shYAP1 #2) or scramble shRNA (shNC) were inserted into pLKO.1-TRC Cloning Vector (Addgene, 10878, RRID: Addgene_10878) following the manufacturer’s protocol and sequenced ...
-
bioRxiv - Cancer Biology 2023Quote: ... For each microgram crude eccDNA we spiked in 1 ng pUC1932 (was a gift from Joachim Messing, Addgene plasmid # 50005; RRID: Addgene_50005) and 1 ng egfr fragment to generate crude circular DNA mixture.
-
bioRxiv - Developmental Biology 2023Quote: ... expressing a dominant negative variant of the rol-6 gene and an empty vector pSK (up to 200 ng μl-1 of DNA) (Addgene) using standard methods (42) ...
-
bioRxiv - Cell Biology 2023Quote: ... We generated monoclonal U2OS cell lines expressing the following fluorescent plasmids: 1) ptfLC3B was a gift from Tamotsu Yoshimori (Addgene plasmid #21074 ...
-
bioRxiv - Molecular Biology 2024Quote: ... A guide RNA sequence was selected to target exon 1 of MTU1 and cloned into LentiCRISPR v2 (a gift from Feng Zhang, Addgene plasmid # 52961 ...
-
bioRxiv - Biochemistry 2024Quote: ... A recombinant expression construct encoding the DOT1L catalytic domain (Uniprot Q8TEK3; residues 1-420) was purchased from AddGene (AddGene #36196). A recombinant expression construct encoding the Haspin kinase domain (GSG2 ...
-
bioRxiv - Neuroscience 2024Quote: ... Each eye was intravitreally injected with 1 μL of AAV2-hSyn-DIO-mCherry (∼8 x 1012 GC/mL, cat. #: 50459-AAV2, Addgene) using a custom Hamilton syringe (Borghuis Instruments ...
-
bioRxiv - Neuroscience 2024Quote: ... Each eye was intravitreally injected with 1 μL of AAV2-hSyn-DIO-hM3Gq-mCherry (∼8 x 1011 GC/mL, Addgene) using a custom Hamilton syringe (Borghuis Instruments ...
-
bioRxiv - Neuroscience 2024Quote: Rats were anesthetized with isoflurane (induction: 4%; maintenance: 1–2.5%) and received either AAV8-hSyn-hM4Di-mCherry (Addgene #50475-AAV8) or AAV8-hSyn-mCherry (Addgene #114472-AAV8) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and annealed and ligated in the pLKO.1 Hygro linearized backbone (a gift from Bob Weinberg, plasmid #24150 on Addgene). Stbl3 bacteria were heat-shocked to uptake ligated plasmid ...
-
bioRxiv - Cancer Biology 2024Quote: ... to target NCL translation start site and the targeting sequence was cloned into pX330-U6-Chimeric_BB-CBh-hSpCas9-hGem (1/110) (Addgene#71707)103 according to standard protocols104 ...