Labshake search
Citations for Addgene :
2601 - 2650 of 2778 citations for 6H 5 Oxa 1 2a 4a triazacyclopenta cd pentalene 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... reporter under the constitutive elongation factor 1-α (EF1α) promoter and upstream of a P2A linker followed by the tdTomato fluorescent protein (gift from Kazuhiro Oka;Addgene plasmid #72486 ...
-
bioRxiv - Genetics 2022Quote: ... sgRNA oligos with BbsI sticky ends (IDT, 25nmole standard desalted, Supplementary Table 1) were ligated into the pDG459 plasmid (Addgene 100901) as previously described 45 ...
-
bioRxiv - Neuroscience 2022Quote: ... we cloned the dgn-1 promoter and AcNPV p10 3’UTR into the vector pPD49.26 (from the Andrew Fire plasmid kit, Addgene Kit #1000000001) to generate plasmid pNTC2 ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV plasmids carrying either cDNA for respective genes downstream of a CMV promoter were co-transfected with pAAV2/1 (Addgene #112862) encoding the AAV genes rep and cap ...
-
bioRxiv - Plant Biology 2023Quote: ... All four Level 1 cassettes were assembled in a one-step reaction into the Level 2 acceptor plasmid (pAGM4723 Addgene #48015) as previously described (Dudley et al. ...
-
bioRxiv - Plant Biology 2023Quote: ... The final construct was assembled by combining the two Level 1 sgRNA cassettes with cassettes for resistance to kanamycin pICSL11024 (Addgene#51144) and constitutive expression of SpCas9 (pEPQD1CB0001 ...
-
bioRxiv - Genomics 2022Quote: sgRNA-CRISPR library targeting 550 chromatin regulators (Suppl Table 1) was ordered from IDT Technologies and cloned using Gibson assembly in CRISP-seq backbone (Addgene #85707). The Gibson assembly product was electroporated in Endura ElectroCompetent cells following the manufacturer’s protocol (Endura #60242-2 ...
-
bioRxiv - Neuroscience 2022Quote: ... Adeno-associated virus for expressing jGCaMP6f or jGCaMP7f under the synapsin-1 promoter (AAV1-syn-jjGCaMP6f-WPRE-SV40, Addgene, 100837; AAV1-syn-jjGCaMP7f-WPRE, Addgene, 104488) was injected into the wS1 at depth of 250 μm below the dura and at a rate of 1 nL/sec (100 nL total) ...
-
bioRxiv - Physiology 2022Quote: ... reporter under the constitutive elongation factor 1-α (EF1α) promoter and upstream of a P2A linker followed by the tdTomato fluorescent protein (gift from Kazuhiro Oka;Addgene plasmid # 72486 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... by high fidelity Q5 polymerase PCR using primer set given table-1 and cloned purified hACE2 gene fragment into NheI and BamHI digested fragment of pLenti backbone (Addgene, 112675) by Gibbson assembly ...
-
bioRxiv - Cell Biology 2024Quote: ... The HTR8 cells with mir-218 KO were generated by cloning gRNAs that target mir-218-1 and mir-218-2 into a CRISPR/Cas9 vector PX459 (Addgene #62988). The plasmid was verified by sequencing ...
-
bioRxiv - Biochemistry 2024Quote: ... pEGFP-C1-tagged plasmids containing the exon 1 of HTT with 23 CAG repeats (GFP-Q23: wild-type HTT. Addgene, #40261) or 74 CAG repeats (GFP-Q74 ...
-
bioRxiv - Cell Biology 2024Quote: ... control or mir-218-1-overexpressing HTR8 cells were seeded into 12-well plates and were co-transfected with 1 µg/mL of 5X NFκB luciferase reporter (64) (Addgene plasmid #12453) construct and 20 ng/mL of Renilla luciferase vector (Promega ...
-
bioRxiv - Cancer Biology 2024Quote: ... ALKBH5 shRNA was generated by ligation of oligonucleotides into the AgeI and EcoRI restriction sites of pLKO.1 (Addgene plasmid #8453). Lentiviral-shRNA particles were generated by transfecting HEK 293T cells with 12 μg of pLJM1 vector containing the shRNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... reporter cell lines were generated by TALEN-mediated homology-directed repair to integrate enhancer reporter donor constructs into the AAVS1 locus by electroporation of 1 × 106 K562 cells (or K562 cells selected to have the desired synthetic transcription factor) with 1 ng of reporter donor plasmid and 0.5 ng of each TALEN-L (Addgene no. 35431) and TALEN-R (Addgene no ...
-
bioRxiv - Neuroscience 2024Quote: ... we used OT-IRES-Cre pups injected at P0 into the PVN with a Cre-dependent rAAV2/1 vector expressing eOPN3 (pAAV-hSyn1-SIO-eOPN3-mScarlet-WPRE; Addgene #125713).
-
bioRxiv - Cell Biology 2024Quote: Individual single-guide RNAs (sgRNAs) (sgBTN3A2 #1: TGTTCTCTCCCTTGGCGTTGCTCCACTGTA; sgBTN3A2 #3: ATCATGAGAGGCGGCTCCGGGGAGGGTGTATC) targeting the candidate gene were cloned into linearized lentiCRISPRv2 (#52961, Addgene, USA). Lipofectamine™ 3000 transfection reagent in Opti-MEM medium was used to co-transfect HEK293T cells with psPAX2 (#12260 ...
-
bioRxiv - Cell Biology 2022Quote: ... replication-deficient lentiviruses were produced and titrated as described by co-transfection of the resulting constructs in HEK-293T cells with the HIV-1 packaging plasmid psPAX2 (Addgene #12260) and the plasmid pMD2.G (Addgene #12259 ...
-
bioRxiv - Immunology 2023Quote: Pseudovirus expressing Wuhan-Hu-1 SARS-CoV-2 S protein were produced by co-transfection of plasmids encoding a GFP protein (Addgene, 11619), a lentivirus backbone (VRC5602 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Microdomain targeting was accomplished using N-terminal fusions of tags to the matrix using 2xCOX8A (tag corresponds to Cox8A N-terminal residues 1-25, from Addgene 136470), the IMS using SMAC (residues 1-59 ...
-
bioRxiv - Neuroscience 2023Quote: ... Adeno-associated virus for expressing GcaMP7f or 8f under the synapsin-1 promoter (AAV1-syn-jGCaMP7f-WPRE; Addgene 104488; AAV1-syn-jGCaMP7f-WPRE, Addgene 162376) was injected into the wS1 at depths of 250 μm and 120 μm below the dura and at a rate of 1 nL/sec (50 nL total per location) ...
-
bioRxiv - Neuroscience 2023Quote: A Cre-dependent inhibitory optogenetic construct halorhodopsin (eNpHR, AAV5-Ef1a-DIO eNpHR 3.0-EYFP at titer ≥ 1×10¹³ vg/mL, Addgene plasmid # 26966) or an empty vector (control ...
-
bioRxiv - Cancer Biology 2023Quote: ... AAACTCGGAGTTCTCAGAGCCCAGC NFKB2 guide #1 F: CACCGTGGCCCCTACCTGGTGATCG NFKB2 guide #1 R: AAACCGATCACCAGGTAGGGGCCAC NFKB2 guide #2 F: CACCGCTTTCGGCCCTTCTCACTGG NFKB2 guide #2 R: AAACCCAGTGAGAAGGGCCGAAAGC pLKO.TRC (Addgene; Cat#10878) was used for generating shNMNAT1 KD in U-87 MG and U-251 MG cell lines ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/1-DIO-EF1α-mVenus-biPAC (Boston Children’s Hospital Vector Core) and AAV1-Syn-Flex-NES-jRCaMP1a-WPRE-SV40 (Addgene 100848-AAV1) were unilaterally injected into the PVH of MC4R-2A-Cre mice (1:1 mixture ...
-
bioRxiv - Developmental Biology 2023Quote: 2.5×105 hESCs (AIC-hESCs or AIC-N hESCs) were electroporated with 1 μg of donor plasmid AAVS1-CAG-hrGFP (Addgene, #52344) or AAVS1-Pur-CAG-mCherry (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... Briefly we expressed GCaMP6s41 or JrGeco1a42 by microinjection of AAV2/1-hSyn-GCaMP6s/JrGeco1a-WPRE-SV40 (University of Pennsylvania Vector Core or Addgene®) into the visual cortex 1- 4 weeks before imaging experiments ...
-
bioRxiv - Neuroscience 2023Quote: ... transfection mix for each plasmid was prepared in the following manner: 1 µg of transfer plasmid and 2 µg of second-generation packaging DNA mix containing psPAX (Addgene #12260) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Neuroscience 2023Quote: We used AAV-9-syn-GCaMP6s vector with synapsin promoter (pGP-AAV-syn-GCaMP6s-WPRE.4.641 at a titre of 1x1013 GC·ml-1, Addgene, Watertown, MA, USA), and therefore it transduced neurons showing higher tropism for the AAV 2/9 subtype ...
-
bioRxiv - Plant Biology 2023Quote: ... the coding sequence of each transcription factor and the YFP coding sequence were cloned into pUAP4 in one-step restriction-ligation reactions to create Level 0 parts (with stop codons) that were subsequently assembled into the level 1 Loop acceptor (pCk2; Addgene #136696) in one-step restriction-ligation reactions with a CaMV35sP-ΩTMV (pICH51277 ...
-
bioRxiv - Developmental Biology 2023Quote: ... the three sgRNA expression cassettes were subcloned one by one from the three lentiGuide-Puro plasmids into a modified pLKO.1-TRC plasmid (additional multiple cloning site BclI-EsrGI-MluI-NheI-PstI-SalI-XbaI-XmaI was inserted between the original PpuMI and EcoRI sites in the pLKO.1-TRC plasmid (Addgene # 10878)) to make tandem sgRNA expression cassettes in the same lentiviral vector.
-
bioRxiv - Plant Biology 2023Quote: ... These Level 0 promoter parts were used in in one-step digestion-ligation reactions with the Level 1 Loop pCk1 (Addgene #136695) backbones together with parts containing LucN (pEPYC0CM0133 ...
-
bioRxiv - Neuroscience 2023Quote: ... we expressed GCaMP6s by direct microinjection of AAV2/1-hSyn-GCaMP6s-WPRE-SV40 (Addgene, 100843-AAV1, Titer: 2.5×1013 GC/mL) into the visual cortex ...
-
bioRxiv - Genomics 2023Quote: Two different versions of the Brunello library were used – a “1 vector system” (backbone expresses both Cas9 and the sgRNA library – Addgene #73179) and a “2 vector system” (backbone expresses only the sgRNA library – Addgene #73178) ...
-
bioRxiv - Cell Biology 2023Quote: ... Plasmids that express trak-1 and miro-1 sgRNAs were made by swapping the N19 sequence of the unc-119 sgRNA from the preexisting plasmid (Addgene #46169) (Friedland et al. ...
-
bioRxiv - Plant Biology 2023Quote: Plant codon-optimized HypaCAS9 expressed under the EC1.1 promoter was generated by mutagenesis of the EC1pro:CAS9 sequence from the pHEE401E plasmid (Wang et al., 2015; Addgene Plasmid #71287). Two fragments were amplified by PCR with oligonucleotide primers harboring the hypaCas9 mutations described in Chen et al ...
-
bioRxiv - Biochemistry 2022Quote: ... Immobilized proteins were eluted by incubation with 1 mL of 250 nM SENPEuB protease (expressed and purified from pAV286 (Addgene # 149333))74 overnight at 4° C ...
-
bioRxiv - Cancer Biology 2023Quote: The lentivirus shRNA plasmids targeting mouse RelA and Pkci were generated by cloning annealed oligos into AgeI and EcoRI sites of pLKO.1-hygro-ctrl plasmid (Addgene #24150). Following target sequences and oligos were utilized ...
-
bioRxiv - Cell Biology 2022Quote: ... the PCR-amplified fragment of pie-1p::gfp::PH::pie-1 3’UTR was inserted into pCFJ1662 (a gift from Erik Jorgensen, Addgene #51482). Plasmid mixtures containing pCFJ1662_PH ...
-
bioRxiv - Developmental Biology 2023Quote: ... shortened to 19 bp length and flanked with BbsI overhangs. Corresponding oligonucleotides (Suppl. Table 1) were inserted into BbsI-digested pX330-U6- Chimeric_BB-CBh-hSpCas9 (obtained from Addgene, plasmid #42230) 35 to generate pX330- Ep400-Ex15 and px330-Kat5-Ex8 ...
-
bioRxiv - Microbiology 2023Quote: ... HUDEP-2 were transduced at an MOI <1 with lentivirus prepared from pXPR_101 (lentiCas9-blast, gift from Feng Zhang, Addgene plasmid 52962) and selected with blasticidin ...
-
bioRxiv - Cell Biology 2023Quote: ... CFP-GAI-MTM1 was made by inserting MTM1 from mCherry-FKBP-MTM1 after GAI in CFP-GAI(1-92) (gift from Takanari Inoue, Addgene # 37307). LysoYFP-GID1 was made by inserting Lyso from LysoGFP-Sac1 before YFP in YFP-GID1 (gift from Takanari Inoue ...
-
bioRxiv - Cancer Biology 2024Quote: ... generated by transduction of MDA-MB-231 (named in short MB-231) with lentiviral vectors carrying pLKO.1 plasmid (Addgene, 8453) cloned with shANP32E-808 (sh sequence ...
-
bioRxiv - Cancer Biology 2023Quote: Engineering of Luc-tagged HCC1954 cells (HCC1954-Luc) and tumour implantation: the pLenti CMV Puro LUC (w168-1) was purchased from Addgene (#17477) and used in all in vivo experiments ...
-
bioRxiv - Molecular Biology 2023Quote: ... containing 10% FBS and 1% penicillin-streptomycin, and equal amounts of plasmids (250 ng of each: luciferase reporter, actin-GAL4 (Addgene #24344), one dCas9-Rb constructs ...
-
bioRxiv - Neuroscience 2023Quote: ... To express the calcium indicator GCaMP6s in neuronal cell bodies or long-range projection axons either AAV5-Syn-GCaMP6s or AAV1-Syn-GCaMP6s (1−1013 gc/mL; Addgene #100843) was injected into the relevant brain region ...
-
bioRxiv - Genetics 2024Quote: ... To determine MOI and approximation of appropriate viral volume we infected day 14 iGLUTs (0, 1, 2, 4, 8, 10, 16, 32, 64 µL) with control lentivirus (pLS-SV40-mP-EGFP; AddGene #137724) and harvested for 48hrs later ...
-
bioRxiv - Developmental Biology 2024Quote: ... Individual sgRNAs targeting sites 1-4 of the SABER array were cloned into 4 separate U6x:sgRNA plasmids (Addgene plasmids 64245-64248) as described previously52 ...
-
bioRxiv - Neuroscience 2024Quote: ... An intersectional approach was used for selective activation of mPFC to BLA projection using chemogenetics: 1) retrograde AAV encoding FlpO (0.3 μL, titer ≥ 7 x 1012 GC/ml, Addgene# 55637; RRID:Addgene_55637) were bilaterally injected into BLA (A-P ...
-
bioRxiv - Cancer Biology 2024Quote: Guide RNA (gRNA) sequences targeting neutral sphingomyelinases 1 & 2 and Rab27s a and b were cloned into a lentiCRISPR vector (Addgene (52961) 45 ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 × 106 cells were plated in 60 mm dishes for 24 hours followed by transfection with m6A-Tracer GFP (AddGene, 139403) and DAM-lamin B1 (AddGene ...