Labshake search
Citations for Addgene :
201 - 250 of 587 citations for c Myc Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... The recombinant AAV vector was pseudotyped with AAV5 capsid protein and packaged by Addgene.
-
bioRxiv - Cancer Biology 2023Quote: ... The recombinant plasmids were packaged into the lentivirus with pSPAX2 (Addgene, 12260, RRID: Addgene_12260) and pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: ... The recombinant plasmids were packaged into the lentivirus with pSPAX2 (Addgene, 12260, RRID: Addgene_12260) and pMD2.G (Addgene ...
-
bioRxiv - Neuroscience 2020Quote: ... pLenti c-Jun was created by cloning human c-Jun from PMIEG3-c-Jun (a gift from Alexander Dent (Addgene plasmid #40348)[50] using BAMHI and XHOI into pLenti-puro (a gift from Ie-Ming Shih (Addgene plasmid #39481 ...
-
bioRxiv - Cell Biology 2020Quote: ... pcDNA4-Flag-TIMELESS-myc-6xHis and pcDNA3-Flag-TIPIN were a gift from Aziz Sancar (Addgene plasmids #22887 and #22889). pcDNA3.1-Flag-CLASPIN was a gift from Michele Pagano (Addgene plasmid #12659) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Amplified PCR products were fused to biotin ligases via In-Fusion Recombination into myc-BioID2 pBabe (Addgene #80900; XhoI/PmeI), BioID2-HA pBabe (Addgene #120308 ...
-
bioRxiv - Cancer Biology 2020Quote: ... modified to express human histone H2B tagged at the N-terminus with GFP (pLVX-myc-EmGFP-H2B) plus psPAX2 and pMD2.G (gifts from Didier Trono, Addgene) using 16.6 mM CaCl2 in DMEM supplemented with 10% Hyclone™ serum (GE Healthcare ...
-
bioRxiv - Immunology 2019Quote: ... pMul1-FLAG and pAsc-Myc were subcloned into pLenti X2 Hygro DEST (a gift from Eric Campeau and Paul Kaufman, w17-1, #17295, Addgene) and transfected into HEK293T cells together with the helper plasmid (psPAX2 ...
-
bioRxiv - Neuroscience 2019Quote: The overexpression experiments in HEK-293T cells were performed using the following constructs: C2-eGFP-hDNMT3A (Clontech, subcloned from pcDNA3/Myc-DNMT3A1, which was a gift from Arthur Riggs, Addgene plasmid #35521 [4] ...
-
bioRxiv - Genetics 2019Quote: ... The pRK5-myc-Cdc42 plasmid and the constitutively active L61Q and dominant negative T17N variants were all obtained from Addgene. The Cdc42 mutants (R186C ...
-
bioRxiv - Cell Biology 2022Quote: ... BirA-ACLY constructs were generated by inserting human ACLY into pcDNA3.1 mycBioID vector (N-terminal MYC-BirA, Addgene, plasmid 35700) with a 16 or 46 amino acid linkers between ACLY and BirA ...
-
bioRxiv - Cell Biology 2022Quote: ... the retroviral FLAG-5SA-YAP and FLAG-5SA-S94A-YAP plasmids were generated via restriction-based cloning from pQCXIH-Myc-YAP-5SA (Addgene plasmid #33093 36 and pCMV-Flag-YAP-5SA/S94A (Addgene plasmid #33103 42 ...
-
bioRxiv - Cell Biology 2022Quote: ... the retroviral FLAG-5SA-YAP and FLAG-5SA-S94A-YAP plasmids were generated via restriction-based cloning from pQCXIH-Myc-YAP-5SA (Addgene plasmid #33093 36 and pCMV-Flag-YAP-5SA/S94A (Addgene plasmid #33103 42 ...
-
bioRxiv - Pathology 2023Quote: ... the HA-hOPA1-myc sequence was amplified and inserted into pJFRC81-10XUAS-IVS-Syn21-GFP-p10 (ID36432, Addgene, Massachusetts, USA) using primers with the N-terminal containing the Kozak and HA sequences (TTACTTCAGGCGGCCGCGGCCAAAATGTACCCATACGATGTTCCAGATTAC ...
-
bioRxiv - Cell Biology 2023Quote: ... they were electroporated with Yamanaka’s plasmids (plasmid numbers 27078 (human SOX2 and KLF4), 27080 (human L-MYC, LIN28), 27077 (human OCT3/4, shRNA against TP53) from Addgene, www.addgene.org ...
-
bioRxiv - Cell Biology 2023Quote: ... The DNA fragment encoding integrin β4 was amplified from pcDNA3.1/Myc-His beta4 (a gift from Filippo Giancotti, Addgene #16039), and then inserted into the pEGFP-N1 vector for the expression of β4-GFP ...
-
bioRxiv - Immunology 2023Quote: ... LentiCRISPRv2–sgRNA Myc transfer plasmids was co-transfected with packaging plasmids psPAX2 and pMD2.G (Addgene plasmids #12259 and #12260) into HEK293T cells ...
-
bioRxiv - Immunology 2023Quote: ... Myc overexpression was achieved using the Nucleofector™ II/2b (Amaxa, Koelin, Germany) with pMXs-cMyc plasmid (Addgene plasmids #13375). Naive CD4+ T cells were resuspended in 100μl nucleofector solution (Amaxa ...
-
bioRxiv - Biochemistry 2023Quote: Mass spectrometry sample preparation: N2A cells were transfected with pcDNA3 plasmids containing 2X myc-EXOSC3 or pcDNA3 empty vector (Addgene) using Lipofectamine® 2000 (Thermofisher ...
-
bioRxiv - Cancer Biology 2023Quote: ... tagged at the N-terminus with three copies of a hemagglutinin tag (3X-HA) (pLV-tetO-myc T58A was a gift from Konrad Hochedlinger; plasmid # 19763) were obtained from Addgene and sequence verified prior to use ...
-
bioRxiv - Biochemistry 2020Quote: ... pDEST26-C-FLAG (Addgene #79275) [22] vector ...
-
bioRxiv - Biochemistry 2022Quote: ... mEmerald-JUP-C-14 (Addgene plasmid # 54132 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and c-Met (Addgene; 31784) plasmids were purchased from Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: ... pOPARA2 or pPGC-C (Addgene plasmid # 174580 ...
-
bioRxiv - Neuroscience 2021Quote: ... HEK293 cells were co-transfected with plasmids encoding wide-type myc-human TREM2 and GFP-human TDP-43 (residues 216-414, Addgene, 28197) or GFP control by the calcium phosphate precipitation method ...
-
bioRxiv - Microbiology 2020Quote: ... pLenti-FAP-GPI was created using the BamHI and NotI sites to move the FAP-GPI sequence from pcDNA-IgKappa-myc-dL5-2XG4S-GPI (Addgene 153308) into pLenti-puro (gift from Ie-Ming Shih ...
-
bioRxiv - Neuroscience 2020Quote: ... Rnd2 and DNRhoA were cloned by PCR using pNeuroD1-Rnd2 (Heng et al., 2008) and pRK5-myc-RhoA-T19N (Addgene 12963) as templates respectively and then inserted into the SfiI/PmeI sites of the CAG-Neurog2-IRES-DsRed retroviral vector (Heinrich et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... potassium channel and tdTomato (separated by an IRES) was generated by subcloning myc-mKCNJ2-T2A-Tomato.pCAG plasmid (#974, Addgene plasmid #60598) into a lentiviral backbone LeGo-iT2 (#809) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Human TBX5 (Horizon Discovery OHS5894-202500411) was gateway sub-cloned from its entry vector pENTR223 into the expression vector pCSf107mT-Gateway-3’myc (Addgene 67617) using clonase (ThermoFisher 11791020 ...
-
bioRxiv - Cancer Biology 2022Quote: ... we used the Gateway recombination system to introduce the following Myc ORF clone HsCD00039771 in pDONR221from the CCSB Human ORFeome Collection into pHAGE-TRE-DEST-NBioTAP (Addgene #53568) and pHAGE-TRE-DEST-CBioTAP lentiviral vectors (Addgene #53569) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The YAP5SA gene was amplified with primers YAP1-5SA-Str-BglII and YAP1-5SA-End-SalI using pQCXIH-Myc-YAP-5SA (Addgene #33093) as a template and ligated into the pAAV-CMV plasmid ...
-
bioRxiv - Cell Biology 2021Quote: ... BFP-EEA1 (#1009) plasmid was generated by subcloning GFP-hEEA1 (#970) into a BFP-hRab7A-Myc backbone (#1005, Addgene Cat# 79803) through ligation of both plasmids after digestion with BamHI (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... fused by PCR using the outer primer pair and cloned into the XbaI and PacI sites of pIRES CAGSS-NLS-mTir-HA-P2A-NES-myc-mTir-IRES-puro (Addgene #117699).
-
bioRxiv - Genomics 2023Quote: ... The transgene was constructed using the Gateway recombination system to introduce the Myc ORF clone HsCD00039771 in pDONR221from the CCSB Human ORFeome Collection into the pHAGE-TRE-DEST-NBioTAP (Addgene #53568) lentiviral vector ...
-
bioRxiv - Immunology 2023Quote: ... Lentiviral vector pLenti-CMV-Puro-DEST containing EGFP-rNLRP1-MYC was transfected into Lenti-X cells together with packaging plasmid psPAX2 (Addgene #12260) and Lentiviral envelope plasmid pMD2.G (Addgene #12259 ...
-
bioRxiv - Neuroscience 2023Quote: ... were expressed in Escherichia coli BL21 (DE3) (New England Biolab, Cat#C2530H) using the bacterial expression vector pGEX-KG myc (Addgene #209891). Following transformation ...
-
bioRxiv - Developmental Biology 2023Quote: ... Human RFX6 cDNA clone was purchased from Horizon Discovery (OHS6084-202637733) and gateway sub-cloned from its entry vector pENTR223 into the expression vector pCSf107mT-Gateway-3⍰myc (Addgene 67617) using clonase (ThermoFisher 11791020 ...
-
bioRxiv - Cancer Biology 2023Quote: ... from the expression vector pcDNA3.1/Myc-His(-)-HSulf-2 bearing human Sulf-2 cDNA (a gift from Steven Rosen, Addgene plasmid # 13004) (Morimoto-Tomita et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... The recombinant plasmid along with a pBabe-puro construct (Addgene, 1764; deposited by Dr. Hartmut Land) expressing mouse ATG16L1 variants was transfected into HEK293 ATG13_KO GFP-LC3B cells via Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Biochemistry 2024Quote: ... NM_018344.6 (SLC29A3):c.1427A>G (p.Ter476Trp) and NM_000343.4(SLC5A1):c.1993T>C (p.Ter665Arg)) were cloned into pCDNA3.1-HA (Addgene 128034) using Gibson assembly ...
-
bioRxiv - Cancer Biology 2020Quote: ... pT3-EF1a-c-Met (31784, Addgene) or pCMV-Hygro-LINC01510 (Twist Bioscience ...
-
bioRxiv - Cell Biology 2021Quote: ... mEmerald-actin-C-18 (Addgene #53978), and mApple-paxillin-22 (Addgene #54935) ...
-
bioRxiv - Cell Biology 2020Quote: ... mCardinal-H2B-C-10 (Addgene #56162)11 ...
-
bioRxiv - Cancer Biology 2022Quote: mCherry-Lamin A/C (Addgene #55068) and mCerulean-Lamin B1 (Addgene #55380 ...
-
bioRxiv - Biochemistry 2021Quote: ... C-terminal MBP plus His6 (Addgene_37237); N-terminal His6 plus glutathione S-transferase (GST ...
-
bioRxiv - Cancer Biology 2021Quote: ... or C-Flag-Rela (Addgene #20012) using 25μL Lipofectamine and 4.5μg plasmid DNA in 600μL Optimem total ...
-
bioRxiv - Neuroscience 2022Quote: ... Yap1 and Yap1-5SA with attB sites were amplified PCR (polymerase chain reaction) from pQCXIH-Myc-Yap1(5SA) (a kind gift from Kunliang Guan, Addgene plasmid # 33093) and pcDNA3-Yap1 (a kind gift from Stefano Piccolo ...
-
bioRxiv - Cancer Biology 2020Quote: ... To knock-out Psat1 in cells isolated from MYC-driven tumours induced in Psat1fl/fl mice the retroviral vector MSCV-CreERT2 puro (Addgene plasmid #22776) was used ...
-
bioRxiv - Genomics 2020Quote: pLPC myc hPOT1 was a gift from Titia de Lange (Addgene plasmid # 12387; http://n2t.net/addgene:12387; RRID:Addgene_12387; (Loayza & De Lange, 2003)) ...
-
bioRxiv - Cell Biology 2023Quote: ... raw files were analyzed with MaxQuant against the same database as described above including sequences of myc-BioID (Plasmid #35700, Addgene, Watertown, MA) and Streptavidin (P22629) ...