Labshake search
Citations for Addgene :
201 - 250 of 1749 citations for Recombinant Human Interleukin 3 Receptor Alpha Low Affinity His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... we used the following emerald-green GFP (emGFP)-tagged vectors from Addgene: BAZ1A (#65371) ...
-
bioRxiv - Neuroscience 2023Quote: ... all NLS tagged RFP constructs with p-EGFP-N1 (Addgene; 6085-1). To qualitatively verify Cre-dependent ArgiNLS variant expression ...
-
bioRxiv - Neuroscience 2023Quote: ... a Streptavidin-binding peptide-FLAG (SFB)-tagged USP7 construct56 (Addgene plasmid #99393) was transfected into HEK293T cells via PEI transfection ...
-
bioRxiv - Molecular Biology 2023Quote: ... The FLAG-HA-tagged YTHDC1 plasmid was purchased from Addgene (plasmid # 85167).
-
bioRxiv - Physiology 2019Quote: ... pcDNA4 myc PGC-1 alpha was a gift from Toren Finkel (Addgene plasmid # 10974). pSG5 PPAR alpha was a gift from Bruce Spiegelman (Addgene plasmid # 22751) ...
-
bioRxiv - Biochemistry 2021Quote: ... HA-HIF1-alpha-pcDNA3 was a gift from William Kaelin (Addgene plasmid # 18949 [50]). pcDNA3 LATS1 was a gift from Erich Nigg (Addgene plasmid # 41156 ...
-
bioRxiv - Cancer Biology 2023Quote: Full length murine Tnf was PCR amplified from GFP-TNF-alpha plasmid (Addgene #28089) via Phusion PCR according to manufacturer’s protocol with the following primer ...
-
bioRxiv - Genetics 2021Quote: ... uracil glycosylase inhibitor (UGI) and 3’UTR of human ATP5B was amplified from the published DdCBE construct (Addgene plasmid no. 157843). The PCR product was digested with the restriction enzymes XbaI and EcoRI ...
-
bioRxiv - Biochemistry 2023Quote: ... or the control vector, or sgRNA vectors targeting human PML exon 3 (sense: CACCGGcggtaccagcgcgactacg, antisense: AAACcgtagtcgcgctggtaccgCC) inserted in pLentiV2 vector (Addgene, 52961) along with pMD2.G and psPAX into 293T cells ...
-
bioRxiv - Biophysics 2020Quote: ... containing N-terminal 6-His-WT-p53 (1-303) (Addgene, 24859), was used to express p53 ...
-
bioRxiv - Developmental Biology 2021Quote: ... SpCas9 was expressed from pET28a-Cas9-His (Addgene plasmid number 98158) and purified in our lab ...
-
bioRxiv - Biochemistry 2021Quote: ... and SARS-CoV-2 nsp14/nsp10-His-3xFlag (Addgene ID 169164) were expressed in baculovirus-infected Sf9 insect cells ...
-
bioRxiv - Plant Biology 2024Quote: ... cells harboring the plasmid p2CT-His-MBP-Lbu_C2c2_WT (Addgene No. 83482) were cultivated with 800 ml autoinduction medium (Studier ...
-
bioRxiv - Neuroscience 2022Quote: ... Addgene) designer receptors exclusively activated by designer drugs (DREADD) or control (pAAV8-hSyn-EGFP; Addgene) were delivered into the dLS as described for GCaMP7 (see 2.4.1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were transfected with tandem mRFP-GFP fluorescent-tagged LC3 (ptfLC3) (Addgene #21074). 24h post-transfection ...
-
bioRxiv - Immunology 2019Quote: ... Expression plasmids encoding EGFP-tagged Rab5a and its mutants were purchased from Addgene, USA ...
-
bioRxiv - Physiology 2019Quote: ... GFP-PGC1 plasmid expressing eGFP-tagged mouse PGC1a was acquired from Addgene(50). For in vivo electroporation ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNAs were tagged with mEmerald (a gift from Michael Davidson, Addgene #53975; RRID:Addgene_53975), mRuby2 (a gift from Michael Davidson ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNAs were tagged with mEmerald (a gift from Michael Davidson, Addgene #53975; RRID:Addgene_53975), mRuby2 (a gift from Michael Davidson ...
-
bioRxiv - Cell Biology 2019Quote: ... Histidine-tagged PKA catalytic subunit (a gift from Susan Taylor, Addgene plasmid #14921) and PKI3 were previously described ...
-
bioRxiv - Microbiology 2021Quote: ... The mCherry-tagged LAMP1 was a gift from Amy Palmer (Addgene plasmid # 45147). The myc-tagged WWOX plasmid was kindly provided by R ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK293T cells were transfected with plasmids expressing Flag-tagged mTOR (Plasmid #26603, Addgene) together with HA-tagged Raptor (Plasmid #8513 ...
-
bioRxiv - Neuroscience 2023Quote: ... HA-tagged SQSTM1 and RFP-LC3 were gifts from Qing Zhong (Addgene, 28027)20 and Tamotsu Yoshimori (Addgene ...
-
bioRxiv - Cancer Biology 2024Quote: ... C-terminally FLAG-tagged ASXL1 p.G646Wfs*12 and p.Y591X were obtained from Addgene. The MSCV-T2A-Puromycin vectors encoding 3xFLAG-tagged full-length ASXL1 and truncated ASXL1 were generated by PCR amplification followed by sub-cloning using Gibson assembly.
-
bioRxiv - Molecular Biology 2024Quote: A pET28b plasmid encoding C-terminal 6xHis-tagged nuclear Pif1 (Addgene plasmid #65047)64 was employed to express and purify Pif1 from E ...
-
bioRxiv - Cancer Biology 2024Quote: ... HA or myc-tagged cDNAs were from Addgene (66851, 66852, 32834, 32836, 32839) or synthesized (IDT) ...
-
bioRxiv - Cell Biology 2020Quote: ... sgRNA oligonucleotides targeting the human Pex5 locus (at 5’-GCTCGCCGGGCACTTCACCC-3’) were ligated into the BbsI site of pSpCas9(BB)-2A-GFP (PX458, Addgene Plasmid #48138) to generate pVD1629 ...
-
bioRxiv - Neuroscience 2020Quote: ... CRISPR guide RNA sequence (sgRNA#3 CTCAACACCATCTTCATCCG) targeting the human NLK locus was cloned into pSpCas9 (BB)-2A-GFP (Addgene #481387 PX458). Wild-type iPSCs were transfected with gRNA and Cas9-expressing plasmid using an Amaxa Nucleofector 2b and successfully transfected cells were collected by FACS ...
-
bioRxiv - Cell Biology 2019Quote: ... was generated by transfecting HEK293T cells with pC13N-dCas9-BFP-KRAB26 and TALENS targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using DNA-In Stem (VitaScientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... iPSCs were transfected with pC13N-dCas9-BFP-KRAB and TALENS targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using DNA In-Stem (VitaScientific) ...
-
bioRxiv - Bioengineering 2023Quote: ... iPSCs were transfected with LSD-dCas9-BFP-KRAB and TALENS targeting the human CLYBL safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using transfection reagent ...
-
Intra-mitochondrial proteostasis is directly coupled to alpha-synuclein and Amyloid β 1-42 pathologybioRxiv - Neuroscience 2020Quote: ... Alpha-synuclein-EYFP was then cloned into the pLJM1 backbone for lentiviral expression (Addgene: 19319) (68) ...
-
bioRxiv - Physiology 2021Quote: ... The alpha myosin heavy chain/puro rex/neo was a gift from Mark Mercola (Addgene plasmid #21230 ...
-
bioRxiv - Developmental Biology 2022Quote: αBTX mRNA was synthesized from the Pmtb-t7-alpha-bungarotoxin vector (Megason lab, Addgene, 69542) as described in Swinburne et al ...
-
bioRxiv - Cell Biology 2023Quote: ... which was a gift from Alpha Yap (Addgene plasmid # 71366; http://n2t.net/addgene:71366; RRID:Addgene_71366) (Han et al. ...
-
bioRxiv - Microbiology 2023Quote: ... The pET21a-alpha-synuclein was obtained from Michael J Fox Foundation MJFF (Addgene plasmid # 51486) as a kind gift ...
-
bioRxiv - Cancer Biology 2022Quote: ... human E2F5 and human DP1 were purchased from Addgene, whereas the ORF encoding human p130 from Origene.
-
bioRxiv - Biochemistry 2019Quote: ... pMAL-his-LbCpf1-EC was a gift from Jin-Soo Kim (Addgene plasmid # 79008 ...
-
bioRxiv - Biochemistry 2021Quote: The plasmid SARS-CoV-2 3xFlag-His-nsp5CS-nsp15 (Addgene ID: 169166) was used to express 3xFlag-His-nsp5CS-nsp15 in baculovirus-infected insect cells (Supplementary Table S1 and S2) ...
-
bioRxiv - Immunology 2022Quote: ... pVitro-hygro-N-myc-hVps34/Vps15-C-V5-his-plasmid (Addgene #24055), pEGFP-Atg14L (Addgene #21635 ...
-
bioRxiv - Biochemistry 2022Quote: pQE-60 roGFP2-His was a gift from Tobias Dick (Addgene #65046)(50) ...
-
bioRxiv - Cell Biology 2024Quote: ... Plasmid for expression of EPS15-GFP-His was obtained from Addgene (#170860). EPS15D177S was generated using QuickChange Lightning Site-Directed Mutagenesis Kit (Agilent ...
-
bioRxiv - Cancer Biology 2021Quote: ... we cloned Myc-FLAG tagged POT1 into T7 expression vector (pcDNA 5/FRT, Addgene) and performed site-directed mutagenesis ...
-
bioRxiv - Immunology 2019Quote: ... DNA sequence encoding microRNA-722 tagged with Dendra2 were amplified from (Addgene plasmid # 97163) with the following primers ...
-
bioRxiv - Cancer Biology 2020Quote: The vector for V5-tagged active WNT11 was a gift from Xi He (Addgene plasmid #43824 ...
-
bioRxiv - Cancer Biology 2022Quote: ... pLV-ER GFP encoding GFP tagged SEC61β was a gift from Pantelis Tsoulfas (Addgene plasmid #80069 ...
-
bioRxiv - Neuroscience 2021Quote: ... HA-tagged Nlgn1 plasmid was a gift from Peter Scheiffele (Addgene plasmid # 15260; RRID:Addgene_15260) (Chih et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... HA-tagged Nlgn1 plasmid was a gift from Peter Scheiffele (Addgene plasmid # 15260; RRID:Addgene_15260) (Chih et al. ...
-
bioRxiv - Cell Biology 2019Quote: ... cells expressing GFP-tagged endogenous CLIC4 were transfected with Cry2PHR-mCH-RhoA (Addgene #42959). Cells were kept in the dark and incubated for 24 hours ...
-
bioRxiv - Biochemistry 2022Quote: ... Plasmids encoding HA-tagged LRR (leucine-rich-repeat) domains of LRRFIP2 (Addgene plasmid # 21152), and Fli1 (Addgene plasmid # 21151) ...