Labshake search
Citations for Addgene :
201 - 250 of 10000+ citations for Rat FAM24A shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... 2μg of target shRNA construct and 2μg of 3:1 ratio of psPAX2 (Addgene) and pMD2.G (Addgene ...
-
bioRxiv - Cell Biology 2019Quote: ... gRNA plasmid (Addgene plasmid #103854) and non-targeting gRNA plasmid (Addgene plasmid #103868 ...
-
bioRxiv - Cell Biology 2024Quote: ... PAX2 plasmid (Addgene, Plasmid # 35002) and pMD2.G plasmid (Addgene ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Plasmids pIB166 (Addgene plasmid # 90189), pIB184-Km (Addgene plasmid # 90195 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Plasmids psPAX2 (Addgene plasmid, 12260) and pMD2.G (Addgene plasmid ...
-
bioRxiv - Biophysics 2024Quote: ... GCaMP plasmid (Addgene plasmid #100843) (Chen et al. ...
-
bioRxiv - Biochemistry 2024Quote: ... plasmids were mixed with helper plasmids pCMVR8.74 (Addgene plasmid #22036) and pCAG-Eco (Addgene plasmid #35617 ...
-
bioRxiv - Molecular Biology 2020Quote: shRNAs targeting PUS7 and RPUSD4 were cloned into the lentiviral vector pLKO-Tet-On (Addgene) digested with AgeI-HF and EcoRI-HF to remove the stuffer sequence ...
-
bioRxiv - Cancer Biology 2020Quote: Two distinct shRNA for each target gene were cloned into pLKO.1 puro (Addgene #8453) according to the corresponding protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... Scramble shRNA was used for control electroporations and was a gift from David Sabatini (Addgene plasmid # 1864 ...
-
bioRxiv - Cancer Biology 2019Quote: Two independent shRNA vectors targeting RB1 were obtained from Addgene (Addgene ID: 25640 and 25641). Lentivirus was produced using standard virus production methods by co-transfecting target and packaging plasmids into HEK293T cells ...
-
bioRxiv - Biochemistry 2024Quote: ... shRNA sequences targeting murine ACLY or non-targeting controls were cloned into LT3-GEPIR (Addgene), the shRNA sequences used were (TGCTGTTGACAGTGAGCGACCGCAGCAAAGATGTTCAGTATAGTGAAGCCACAGA TGTATACTGAACATCTTTGCTGCGGCTGCCTACTGCCTCGGA) ...
-
bioRxiv - Cancer Biology 2023Quote: AW13516 cell lines stably expressing either non-targeting scrambled shRNA (#1864) (Addgene, Cambridge, Massachusetts, USA) or shRNAs targeting C1QBP or TRIM23 were employed to study the effect of knockdown on the tumorigenic potential of cancer cells ...
-
bioRxiv - Genomics 2024Quote: ... oligonucleotide pairs encoding IL1RN shRNAs were annealed and cloned into pSICOR-PGK-puro (Addgene #12084). pSicoOligomaker 1.5 (https://venturalaboratory.com ...
-
bioRxiv - Molecular Biology 2024Quote: Oligoes containing shRNA target sequences were cloned into pLKO.1-blast lentiviral vector (Addgene #26655). shRNA sequences used in this study are listed below.
-
bioRxiv - Cancer Biology 2024Quote: ... Scramble pLKO.1 shRNA control (further termed “scramble”) was a gift from David Sabatini (Addgene plasmid #1864 ...
-
bioRxiv - Genomics 2020Quote: ... transfected with lentiviral transfer plasmids and packaging plasmids helper plasmids pCMV-VSV-G (Addgene plasmid #8454) and pCMVR8.74 (Addgene plasmid #22036 ...
-
bioRxiv - Neuroscience 2021Quote: ... The plasmids were obtained from Addgene (Plasmid#50477 and Plasmid#114469) and packaged by Vigene after in house plasmid preparation ...
-
bioRxiv - Biophysics 2021Quote: ... The LC3-mEYFP plasmid was generated by inserting mEYFP from an mEYFP-C1 vector into pmRFP-LC3 (58) (a gift from Tamotsu Yoshimori, Addgene plasmid # 21075, encoding rat LC3) using digestion with NheI and BglII ...
-
bioRxiv - Cancer Biology 2019Quote: ... Packaging plasmids psPAX2 (Addgene plasmid # 12260) and pMD2.G (Didier Trono ...
-
bioRxiv - Microbiology 2021Quote: Plasmid pVSVΔG-eGFP (Addgene plasmid #31842) was modified to pVSVΔG-Rluc to generate LASV GPC pseudotyped viruses (LASVpv) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmids for SUV39H2 (Addgene plasmid #25115) and G9a (Addgene plasmid #25503 ...
-
bioRxiv - Microbiology 2020Quote: ... The plasmid pX330 (Addgene plasmid 42230) designed for the CRISPR-Cas9 system [25 ...
-
bioRxiv - Immunology 2021Quote: ... psPAX2 packaging plasmid (Addgene plasmid #12260), and pMD2.G envelope plasmid (Addgene plasmid #12259) ...
-
bioRxiv - Microbiology 2022Quote: ... Packing plasmids psPAX2(Addgene, plasmid #12260) and pMD2.G (Addgene ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The plasmid pLp3050sNuc (Addgene plasmid # 122030) [30] was used as the vector backbone for the recombinant plasmids generated in this study ...
-
bioRxiv - Neuroscience 2023Quote: ... one plasmid (px458, Addgene Plasmid #48138) expressing sgRNA as well as Cas9 was used to introduce double-strand-breaks near Exon 7 of SMN2 locus ...
-
bioRxiv - Molecular Biology 2024Quote: ... plasmid F11R pEBio (Addgene plasmid #61486) was modified by moving the 726bp region isolated by digestion ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and plasmid pEcgRNA (Addgene Plasmid #166581) contains spectinomycin resistance ...
-
bioRxiv - Biochemistry 2023Quote: ... The plasmids pCytERM_mScarlet_N1 (Addgene Plasmid # 85066), pC1-HyPer-Red (Addgene Plasmid # 48249) ...
-
bioRxiv - Bioengineering 2022Quote: The pRG2 plasmid (Addgene plasmids #104174) was used for gRNA cloning and pU6-pegRNAGG-acceptor (Addgene plasmids #132777) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Plasmids lentiCas9-Blast (Addgene plasmid 52962), pMD2.G (Addgene plasmid 12259) ...
-
bioRxiv - Cell Biology 2023Quote: ... BANF1 plasmid (pBAF plasmid Addgene #104152) was transformed into E ...
-
bioRxiv - Cancer Biology 2023Quote: ... plentiCRISPRv2-Blast plasmid (Addgene: Plasmid #83480), which contains the Cas9 coding sequence and a cloning site for sgRNA ...
-
bioRxiv - Cancer Biology 2024Quote: ... packaging plasmid psPAX2 (Addgene plasmid #12260), and envelope plasmid pMD2.G (Addgene plasmid #12259 ...
-
bioRxiv - Biophysics 2020Quote: ... psPAX2 packaging plasmid (plasmid #12260) and pMD2.G envelope plasmid (plasmid #12259) were from Addgene (Watertown, MA). N-terminally Cy5-labeled peptides were synthesized and purified to > 95% purity by Gen-Script (Piscataway ...
-
bioRxiv - Cell Biology 2020Quote: ... Lentivirus production and shRNA knockdown were performed according to protocols from Addgene (www.addgene.org/tools/protocols/plko/).
-
bioRxiv - Developmental Biology 2023Quote: Lentiviral shRNA expression constructs were generated by first modifying the pLKO.1 puro vector (Addgene #8453), digesting with BamHI and KpnI and replacing the puromycin resistance cassette with an mCherry coding sequence.
-
bioRxiv - Molecular Biology 2023Quote: shRNA sequence targeting TAL1 3’UTR (CATAACCACTGAAGGGAAT) was cloned to Tet-pLKO-puro vector (Addgene #8453). For lentivirus production ...
-
bioRxiv - Genetics 2023Quote: ... and the annealed sense and antisense shRNA oligonucleotides were cloned into pLKO.1-puro vector (Addgene) for knockdown of human KISS1 ...
-
bioRxiv - Genomics 2022Quote: ... HEK-293T cells were transfected with shRNA constructs and lentiviral packaging constructs pMD2.G (Addgene #12259) and psPAX2 (Addgene #12260) ...
-
bioRxiv - Bioengineering 2023Quote: ... each well received the following plasmids: ZipGFP-Casp3 plasmid (Addgene plasmid #81241) and pcDNA3-PpC_TRIM8_# ...
-
bioRxiv - Cell Biology 2024Quote: ... The plasmids (Addgene PTEN NES Plasmid# 10932, Addgene PTEN NLS Plasmid# 10933) were amplified using the QiagenTN mini prep kit and diluted in a concentration of 1ug/ul ...
-
bioRxiv - Genetics 2021Quote: ... digested hSTARR-ORI plasmid (Addgene plasmid #99296) with NEBuilder HiFi DNA Assembly Master Mix (NEB) ...
-
bioRxiv - Genomics 2020Quote: ... phaffii expression plasmid PP164 (Addgene plasmid #78988); the resulting DNMT3L expression cassette driven by a ppTEF1 promoter was then cloned using Gibson Assembly into each of the constructs expressing single DNMTs described above (Supplementary Table S1) ...
-
bioRxiv - Genomics 2021Quote: ... a packaging plasmid (psPAX2: Addgene plasmid # 12260), and each individual MFN2 expression plasmid in a mass ratio of 0.5/1/0.5 for a total of 2µg ...
-
bioRxiv - Cell Biology 2021Quote: ... psPAX plasmid (Addgene, Watertown, MA, plasmid 12260) and pMD2.G plasmid (Addgene ...
-
bioRxiv - Cancer Biology 2021Quote: ... pENTR1A no ccdB plasmid (Addgene plasmid # 17398) was received by Dr ...
-
bioRxiv - Cell Biology 2021Quote: ... The EGFP-RILP plasmid (Addgene plasmid #110498) (Mainou and Dermody 2012 ...
-
bioRxiv - Cancer Biology 2020Quote: ... digested hSTARR-ORI plasmid (Addgene plasmid #99296) with NEBuilder HiFi DNA Assembly Master Mix (NEB) ...