Labshake search
Citations for Addgene :
201 - 250 of 10000+ citations for Mouse ONECUT3 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: Lentiviral gene-specific shRNAs were prepared in pLKO.1-puro backbone (Addgene # 8453) (identified from verified sequences at https://www.sigmaaldrich.com/US/en/product/sigma/shrna ...
-
bioRxiv - Cancer Biology 2023Quote: ... Specific shRNA oligonucleotides targeting USP39 were cloned into the pLL3.7 lentiviral vector (Addgene). These plasmids ...
-
bioRxiv - Cell Biology 2023Quote: ... YAP-targeting shRNA vectors 1 and 2 refer to pLKO1-shYAP1 (Addgene, #27368) and pLKO1-shYAP2 (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... and Deaf1 shRNAs were cloned into pAAV-Ptet-RFP-shR-rtTA (Addgene, #35625). The Deaf1 and Deaf1-shRNA carrier AAV vectors were transfected with pAAV-R/C (AAV serotype 9 [AAV9] ...
-
bioRxiv - Neuroscience 2019Quote: Mouse Rit2 (mRit2) cloned into pGEX2T was a gift from Julian Downward (Addgene plasmid #55663)[59] ...
-
bioRxiv - Cell Biology 2021Quote: The full length mouse SUMO2 fused to HA (N-terminus) from a plasmid (Addgene 48967) [67] were inserted in the retroviral transfer plasmid pCX4 Puro ...
-
bioRxiv - Cancer Biology 2023Quote: ... GSDME-EGFP or mouse Mlh1 lentiviral vector and packaging plasmids pCMV-VSV-G (Addgene #8454) and psPAX2 (Addgene #12260 ...
-
bioRxiv - Immunology 2024Quote: ... targeting mouse Pvrl2 or Pvr were cloned into pSpCas9(BB)-2A-GFP plasmid (PX458, ADDGENE). 6 μg of each vector was transfected into tumor cells plated on a 6-well plate using FuGENE6 transfection reagent (Promega ...
-
bioRxiv - Cancer Biology 2022Quote: ... The shRNA sequences were cloned into the pSIH1-puro vector (#26597; Addgene, MA, USA). Lentiviruses were produced in 293T cells with a second-generation packaging system containing psPAX2 (#12260 ...
-
bioRxiv - Systems Biology 2020Quote: ... We packaged shRNA lentivirus using pMD2.G (Addgene 12259; a gift from Didier Trono) and psPAX2 (Addgene 12260 ...
-
Optimized RNA-targeting CRISPR/Cas13d technology outperforms shRNA in identifying essential circRNAsbioRxiv - Molecular Biology 2020Quote: ... The oligonucleotides for shRNA were cloned into the pLKO.1-TRC vector (Addgene #10878) using AgeI/EcoRI ...
-
bioRxiv - Genetics 2022Quote: ... UAS-shRNAs were generated according to the TRiP protocol using the pVALIUM20 vector (Addgene) (64) ...
-
bioRxiv - Molecular Biology 2023Quote: ... we cloned the shRNA targeting TET2 into the pLKO.1-blast vector (Addgene #26655). Plasmids were generated using PCR ...
-
bioRxiv - Cancer Biology 2024Quote: ... the shRNA constructs were packaged into second-generation virus particles using psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2μg of target shRNA construct and 2μg of 3:1 ratio of psPAX2 (Addgene) and pMD2.G (Addgene ...
-
bioRxiv - Molecular Biology 2021Quote: Mouse FLAG-Sp7 or osteocrin cDNAs were introduced via lentivirus via pLX_311 backbone (Addgene, plasmid 118018) as previously described [21] ...
-
bioRxiv - Immunology 2021Quote: Full-length mouse and human NLRP3 were cloned into pLenti CMVie-IRES-BlastR (Addgene plasmid #119863). The resulting constructs were further modified by addition of N-terminal FLAG-tag followed by fluorescent protein mScarlet and Tobacco Etch Virus (TEV ...
-
bioRxiv - Cell Biology 2019Quote: ... gRNA plasmid (Addgene plasmid #103854) and non-targeting gRNA plasmid (Addgene plasmid #103868 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Plasmids pIB166 (Addgene plasmid # 90189), pIB184-Km (Addgene plasmid # 90195 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Plasmids psPAX2 (Addgene plasmid, 12260) and pMD2.G (Addgene plasmid ...
-
bioRxiv - Cell Biology 2024Quote: ... PAX2 plasmid (Addgene, Plasmid # 35002) and pMD2.G plasmid (Addgene ...
-
bioRxiv - Molecular Biology 2020Quote: shRNAs targeting PUS7 and RPUSD4 were cloned into the lentiviral vector pLKO-Tet-On (Addgene) digested with AgeI-HF and EcoRI-HF to remove the stuffer sequence ...
-
bioRxiv - Cancer Biology 2020Quote: Two distinct shRNA for each target gene were cloned into pLKO.1 puro (Addgene #8453) according to the corresponding protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... Scramble shRNA was used for control electroporations and was a gift from David Sabatini (Addgene plasmid # 1864 ...
-
bioRxiv - Cancer Biology 2019Quote: Two independent shRNA vectors targeting RB1 were obtained from Addgene (Addgene ID: 25640 and 25641). Lentivirus was produced using standard virus production methods by co-transfecting target and packaging plasmids into HEK293T cells ...
-
bioRxiv - Cancer Biology 2023Quote: AW13516 cell lines stably expressing either non-targeting scrambled shRNA (#1864) (Addgene, Cambridge, Massachusetts, USA) or shRNAs targeting C1QBP or TRIM23 were employed to study the effect of knockdown on the tumorigenic potential of cancer cells ...
-
bioRxiv - Biochemistry 2024Quote: ... shRNA sequences targeting murine ACLY or non-targeting controls were cloned into LT3-GEPIR (Addgene), the shRNA sequences used were (TGCTGTTGACAGTGAGCGACCGCAGCAAAGATGTTCAGTATAGTGAAGCCACAGA TGTATACTGAACATCTTTGCTGCGGCTGCCTACTGCCTCGGA) ...
-
bioRxiv - Genomics 2020Quote: ... transfected with lentiviral transfer plasmids and packaging plasmids helper plasmids pCMV-VSV-G (Addgene plasmid #8454) and pCMVR8.74 (Addgene plasmid #22036 ...
-
bioRxiv - Microbiology 2020Quote: ... the mouse cDNA sequence of IRE1 from MEF cells was inserted into pcDNA3- EGFP plasmid (Addgene #13031), resulting in fusion proteins with the EGFP fused to the carboxy terminus of IRE1 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse SMO (gift from Gregory Pazour, UMass, Worcester, USA; plasmid no. 164532; Addgene (Desai et al., 2020)) ...
-
bioRxiv - Neuroscience 2021Quote: ... The plasmids were obtained from Addgene (Plasmid#50477 and Plasmid#114469) and packaged by Vigene after in house plasmid preparation ...
-
bioRxiv - Cancer Biology 2019Quote: ... Packaging plasmids psPAX2 (Addgene plasmid # 12260) and pMD2.G (Didier Trono ...
-
bioRxiv - Microbiology 2021Quote: Plasmid pVSVΔG-eGFP (Addgene plasmid #31842) was modified to pVSVΔG-Rluc to generate LASV GPC pseudotyped viruses (LASVpv) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmids for SUV39H2 (Addgene plasmid #25115) and G9a (Addgene plasmid #25503 ...
-
bioRxiv - Microbiology 2020Quote: ... The plasmid pX330 (Addgene plasmid 42230) designed for the CRISPR-Cas9 system [25 ...
-
bioRxiv - Immunology 2021Quote: ... psPAX2 packaging plasmid (Addgene plasmid #12260), and pMD2.G envelope plasmid (Addgene plasmid #12259) ...
-
bioRxiv - Microbiology 2022Quote: ... Packing plasmids psPAX2(Addgene, plasmid #12260) and pMD2.G (Addgene ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The plasmid pLp3050sNuc (Addgene plasmid # 122030) [30] was used as the vector backbone for the recombinant plasmids generated in this study ...
-
bioRxiv - Neuroscience 2023Quote: ... one plasmid (px458, Addgene Plasmid #48138) expressing sgRNA as well as Cas9 was used to introduce double-strand-breaks near Exon 7 of SMN2 locus ...
-
bioRxiv - Biochemistry 2023Quote: ... The plasmids pCytERM_mScarlet_N1 (Addgene Plasmid # 85066), pC1-HyPer-Red (Addgene Plasmid # 48249) ...
-
bioRxiv - Bioengineering 2022Quote: The pRG2 plasmid (Addgene plasmids #104174) was used for gRNA cloning and pU6-pegRNAGG-acceptor (Addgene plasmids #132777) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Plasmids lentiCas9-Blast (Addgene plasmid 52962), pMD2.G (Addgene plasmid 12259) ...
-
bioRxiv - Cell Biology 2023Quote: ... BANF1 plasmid (pBAF plasmid Addgene #104152) was transformed into E ...
-
bioRxiv - Cancer Biology 2023Quote: ... plentiCRISPRv2-Blast plasmid (Addgene: Plasmid #83480), which contains the Cas9 coding sequence and a cloning site for sgRNA ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and plasmid pEcgRNA (Addgene Plasmid #166581) contains spectinomycin resistance ...
-
bioRxiv - Molecular Biology 2024Quote: ... plasmid F11R pEBio (Addgene plasmid #61486) was modified by moving the 726bp region isolated by digestion ...
-
bioRxiv - Biophysics 2020Quote: ... psPAX2 packaging plasmid (plasmid #12260) and pMD2.G envelope plasmid (plasmid #12259) were from Addgene (Watertown, MA). N-terminally Cy5-labeled peptides were synthesized and purified to > 95% purity by Gen-Script (Piscataway ...
-
bioRxiv - Bioengineering 2023Quote: ... each well received the following plasmids: ZipGFP-Casp3 plasmid (Addgene plasmid #81241) and pcDNA3-PpC_TRIM8_# ...
-
bioRxiv - Cell Biology 2020Quote: ... Lentivirus production and shRNA knockdown were performed according to protocols from Addgene (www.addgene.org/tools/protocols/plko/).
-
bioRxiv - Molecular Biology 2023Quote: shRNA sequence targeting TAL1 3’UTR (CATAACCACTGAAGGGAAT) was cloned to Tet-pLKO-puro vector (Addgene #8453). For lentivirus production ...