Labshake search
Citations for Addgene :
201 - 250 of 2646 citations for Mouse EGF Latrophilin Seven Transmembrane Domain Containing Protein 1 ELTD1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... Mouse H2A.Z.1 gene in pIND-EGFP was a kind gift from from Danny Rangasamy (Addgene plasmid # 15770 ...
-
bioRxiv - Microbiology 2019Quote: ... 2.18 μg of env-defective HIV-1 provirus containing GFP reporter was cotransfected with 0.31 μg pMD2.G VSV G plasmid (Addgene #12259). Simian immunodeficiency virus (SIV)−VLPs containing Vpx were produced by the transfection of 2.18 μg pSIV−Δpsi/Δenv/ΔVif/ΔVpr (Addgene #132928 ...
-
bioRxiv - Synthetic Biology 2019Quote: We first obtained the yeast strain containing the reporter gene by integrating (lexA-box)x-PminCYC1-Citrine-TCYC1 plasmids (x = 4, 2 or 1) (Addgene plasmids #58434 ...
-
bioRxiv - Cell Biology 2022Quote: ... RPE-1 TUB-mRFP cells were generated in our lab by transduction with lentiviral vectors containing tubulin m-RFP (Addgene). HEK293T cells at a 50-70% confluence were co-transfected with lentiviral packaging vectors (16.6 μg of Pax2 ...
-
bioRxiv - Neuroscience 2023Quote: ... E15 wild-type embryos were unipolar injected into the ventricle using a pulled glass micropipette containing a DNA solution (1 μg/μl CAG-GFP plasmid (11150, Addgene) with 0.03% Fast Green in PBS) ...
-
bioRxiv - Neuroscience 2023Quote: ... LR reaction was performed using R83B04 containing entry vector and lexA containing (pBPLexA::p65Uw) destination vector (Addgene: 26231). Transgenic fly generation was conducted by GenetiVision ...
-
bioRxiv - Microbiology 2020Quote: ... A plasmid containing the ACE2 gene (Addgene) was digested with Nhe I and Kpn I and the fragment was ligated into the similarly digested pLenti-III-HA vector plasmid ...
-
bioRxiv - Cell Biology 2021Quote: Plasmids containing sirtuins were ordered from Addgene, and all of them were produced by Eric Verdin ...
-
bioRxiv - Molecular Biology 2021Quote: ... a vector containing 24xMS2v6 (Addgene Plasmid #104391) was double-digested and the MS2 cassette was gel purified ...
-
bioRxiv - Immunology 2021Quote: ... along with the DHFR containing vector (Addgene) to produce 2H1-mIgG3-CH1a-1 ...
-
bioRxiv - Genomics 2021Quote: ... gene fragment containing CTT pegRNA (Addgene #132778) was PCR amplified using primer sets adding 5-bp degenerate barcode and flanking BsmBI site for the downstream cloning steps ...
-
bioRxiv - Cancer Biology 2022Quote: Plasmids containing AcGFP and LbNOX (Addgene #75285) were gifts from Dr ...
-
bioRxiv - Cell Biology 2023Quote: ... pT7-EGFP-C1-HsDCP1a was a gift from Elisa Izaurralde (Addgene plasmid # 25030; http://n2t.net/addgene:25030;RRID:Addgene_25030) (Tritschler et al. ...
-
bioRxiv - Plant Biology 2019Quote: ... the resulting gRNA plasmids were then recombined with a L1 construct containing pYAO:Cas9_3:E9t39 (kindly provided by Jonathan Jones) and a L1 construct containing Fast-Red selection marker (AddGene #117499) into a L2 binary vector (AddGene #112207).
-
bioRxiv - Plant Biology 2019Quote: ... DNA-oligonucleotides (Figure 2-source data 1) containing the specific gRNA sequence were synthesised and used to amplify the full gRNA from a template plasmid (AddGene #46966). Using Golden Gate cloning40 each gRNA was then recombined in a L1 vector downstream of U6 promoter39 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Site-directed integration into attP sites was achieved by co-injection of an attB-containing vector (400 ng µl-1) and pBS130 (encoding phiC31 integrase under control of a heat shock promoter (Addgene #26290) [73]) ...
-
bioRxiv - Developmental Biology 2019Quote: ... using AscI and NotI-containing primers and cloned the fragment into the vector p-attB-min.hsp70P-FRT-STOP#1-FRT-DamMyc[open] (Addgene plasmid #71809). Transgenic lines were generated by Genetivision Inc ...
-
bioRxiv - Cancer Biology 2020Quote: ... a sox10 minimal promoter was PCR amplified from genomic DNA from AB* larvae with primers (Table 1 and 2) containing overlapping nucleotides to sequences on either side of the AgeI site in pENTR-EGFP2 (Addgene #22450), similarly described in (Quillien et al. ...
-
bioRxiv - Immunology 2022Quote: ... Vector psPAX2 containing the untagged coding sequence for HIV-1 gag-pol was a gift from Didier Trono (Addgene plasmid # 12260).
-
bioRxiv - Cell Biology 2021Quote: ... A gBlock containing sequence for SNAP-V5 tags was inserted into pLenti CMVTRE3G eGFP Blast (w818-1) (gift of Eric Campenau, Addgene #27568) at the AgeI restriction site using Gibson Assembly to make pLTRE3G-SNAP-V5-eGFP ...
-
bioRxiv - Cancer Biology 2021Quote: ... were amplified using primers containing overhangs with the homology sites for GMAP cloning and inserted into a lentiviral vector (LV 1-5, Addgene, 68411). This lentiviral backbone was a gift from Dr ...
-
bioRxiv - Cell Biology 2022Quote: ... were amplified using primers containing overhangs with the homology sites for GMAP cloning and inserted into a lentiviral vector (LV 1-5; Addgene, 68411). IL6-EGFP from pmIL-6promoterEGFP (Addgene 112896) ...
-
bioRxiv - Molecular Biology 2023Quote: Two oligos H3F3AN-1-73F CACCGTCAATGCTGGTAGGTAAGTA and H3F3AN-1-73R AAACTACTTACCTACCAGCATTGAC containing gRNA sequence were annealed and inserted into pSpCas9-2A-Puro vector (PX459, Addgene # 62988), digested with BbsI-HF enzyme (NEB ...
-
bioRxiv - Neuroscience 2023Quote: ... Site-directed integration into attP sites was achieved by co-injection of an attB-containing vector (400 ng µl-1) and pBS130 (encoding ΦC31 integrase under control of a heat shock promoter (Addgene #26290)60) ...
-
bioRxiv - Neuroscience 2023Quote: ... transfection mix for each plasmid was prepared in the following manner: 1 µg of transfer plasmid and 2 µg of second-generation packaging DNA mix containing psPAX (Addgene #12260) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Biochemistry 2024Quote: ... pEGFP-C1-tagged plasmids containing the exon 1 of HTT with 23 CAG repeats (GFP-Q23: wild-type HTT. Addgene, #40261) or 74 CAG repeats (GFP-Q74 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Samples were incubated with Protein A/G-MNase fusion protein (Addgene, Cat #123461) at 700 ng/mL for 1 hour at 4°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse TRIM21 (Addgene #105516) and CRY2Clust (Park et al. ...
-
bioRxiv - Developmental Biology 2020Quote: ... mouse Ebf1 cDNA (Addgene) was cloned into pLVX Tet-One Puro plasmid (Clontech) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... mouse Gqα15 (Addgene #40753) (Offermanns and Simon ...
-
bioRxiv - Biophysics 2020Quote: ... Dual transfections containing mCh-Drp1 (Addgene, plasmid #49152) and Mito-GFP (gift from Hari Shroff ...
-
bioRxiv - Systems Biology 2021Quote: ... Sleeping Beauty transposase containing pSB100 vector (Addgene #34879) was a kindly gift of Dr ...
-
bioRxiv - Neuroscience 2020Quote: ... The AAV vector containing floxed ChR2 (Addgene #20297) and floxed eNpHR (Addgene #26966 ...
-
bioRxiv - Genetics 2022Quote: ... Jurkat cells containing pLenti-PE2-BSD (Addgene, #161514) were treated with 10 μg/ml blasticidin for selection of blasticidin and incubated for 72 hours ...
-
bioRxiv - Cell Biology 2021Quote: FRET biosensor containing vectors: pTriEx4-Rac1-2G (Addgene plasmid # 66110 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: pBABE retroviral vector containing GFP-LC3 (Addgene, 22405) was transfected into PT67 cells (ATCC ...
-
bioRxiv - Neuroscience 2022Quote: ... into a pAAV backbone containing stChrimsonR-mRuby2 (RRID:Addgene_105447) and packaged into an AAV (Vigene ...
-
bioRxiv - Molecular Biology 2022Quote: ... Jurkat cells containing pLenti-PE2-BSD (Addgene, #161514) were treated with 10 µg/ml blasticidin for selection of blasticidin and incubated for 72 hours ...
-
bioRxiv - Neuroscience 2023Quote: Plasmids containing pAAV-hsyn-ChrimsonR-tdTomato (Addgene # 59171) (51 ...
-
bioRxiv - Immunology 2023Quote: A lentiviral construct containing human ACE2 (Addgene 155295) or mScarlet (Addgene 85044 ...
-
bioRxiv - Physiology 2023Quote: ... containing human Fis1 gene were purchased from Addgene. The working viral vectors were constructed from these two plasmids by Custom DNA Constructs ...
-
bioRxiv - Molecular Biology 2023Quote: ... MED1-IDR containing plasmid was obtained from Addgene #145276 and inserted into pcDNATM6.2-C-EmGFP-DEST supplemented with the Simian Virus 40 NLS sequence by Gateway strategy (Invitrogen ...
-
bioRxiv - Biophysics 2023Quote: ... Separate lentivectors containing EGFP-NPM1 (Addgene plasmid # 17578) and mRuby2-Lamin A/C (Addgene plasmid # 55901 ...
-
High-performance GPCR optogenetics based on molecular properties of animal opsins, MosOpn3 and LamPPbioRxiv - Biochemistry 2022Quote: ... The vector backbone containing SL1 and GFP was obtained by digestion of the plasmid [pEM1 = flp-21::LoxPStopLoxP::npr-1 SL2 GFP] (Addgene plasmid # 24033)65 with NotI and KpnI ...
-
bioRxiv - Molecular Biology 2022Quote: ... pcDNA3.1-HA-UBA6, containing the coding sequence for UBA6 (aa1-1052, Uniprot: A0AVT1) was a gift from Marcus Groettrup (Addgene plasmid #136995). UBA6 was subcloned into pDARMO with an N-terminal FLAG-tag ...
-
bioRxiv - Neuroscience 2023Quote: ... a 10-fold serial dilution in H20 was prepared of a commercially available bacterial plasmid (pBR322) containing the JCPyV Mad-1 full sequence (girt from Peter Howley, Addgene plasmid # 25626) [46] ...
-
bioRxiv - Immunology 2021Quote: ... green fluorescence protein (GFP) or an enhanced yellow fluorescent protein (EYFP) sequence (pcDNA1.3-, Addgene) using standard cloning methods ...
-
bioRxiv - Genetics 2019Quote: ... mCherry fluorescent protein marker (Addgene), and ampicillin resistance gene ...
-
bioRxiv - Immunology 2019Quote: ... were incorporated into two complementary 100-mer oligonucleotides and cloned into a gRNA containing plasmid containing the (NeoR/KanR) cassette (Addgene # 41824). The human codon optimized pCAGGS-Cas9-mCherry was used for gene-editing experiments (a gift from Stem Cell Core Facility at Columbia University) ...
-
bioRxiv - Molecular Biology 2023Quote: ... An unmethylated plasmid containing the rDNA promoter sequence and/or an unmethylated plasmid containing the HpaII cut site (pUC19, Addgene# #50005) were digested alongside the experiments to ensure efficient digestion ...