Labshake search
Citations for Addgene :
201 - 250 of 2238 citations for Human Mitochondrial Genome Maintenance Exonuclease 1 MGME1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... smegmatis strain harboring the PwhiB7:zeoR construct was transformed with the genome-wide CRISPRi library described in Bosch et al.30 (Addgene 163955) with greater than 400-fold coverage ...
-
bioRxiv - Bioengineering 2023Quote: ... Strains for evaluating the effect of Csy4 on genome editing efficiency were created by BY4742 integration of plasmids pZS.157 (Addgene #114454) or pSCL.390 ...
-
bioRxiv - Cell Biology 2023Quote: Cas9-expressing Ctgf-P2A-GFP C2C12 cells were infected with validated lentiviral particles generated from a whole-genome CRISPR-Brie library (Addgene, #73632). After 24 hours ...
-
bioRxiv - Microbiology 2024Quote: HeLa-TetR-Cas9 clonal cells used in the genome-wide screen and polyclonal Huh7 cells transduced with 311-Cas9 (Plasmid Addgene #96924) and selected using 10 µg/mL blasticidin for 7 days were used for secondary screening ...
-
bioRxiv - Cancer Biology 2024Quote: ... The promoter- or enhancer-targeting sgRNAs and non-targeting sgRNAs with no genome recognition sites were cloned into LentiGuide-Puro (Addgene: 52963). The cells stably expressing dCas9-KRAB-MeCP2 were infected with these vectors and then selected with puromycin (2 ug/ml ...
-
bioRxiv - Neuroscience 2023Quote: ... were cloned by PCR amplification of the full-length human GPCR cDNA library (hORFeome database 8.1) or the PRESTO-Tango GPCR Kit36 (Addgene Kit #1000000068). To optimize the 5-HT sensors ...
-
bioRxiv - Cell Biology 2022Quote: Human FL-RING1A (1–406aa) and CSD HP1β(80–185aa) were subcloned into bacterial expression 1GFP vector (Addgene #29663) and 1B vector (Addgene #29653) ...
-
bioRxiv - Microbiology 2020Quote: ... DNA encoding residues 1-177 of both human RAC1 and CDC42 were cloned into an unmodified pET-28a (Addgene) vector that encodes an N-terminal TEV-cleavable 6xHis-tag using the NdeI/XhoI sites ...
-
bioRxiv - Neuroscience 2023Quote: ... 6 × 107 RPE1 cells were infected with the human sgRNA library (Human GeCKO v2 Library Cat#1000000048, Addgene) at an MOI of ∼0.3 ...
-
bioRxiv - Cell Biology 2020Quote: ... was integrated in the U2OS genome using F-Talen and R-Talen (pZT-C13-R1 and pZT-C13-L1, Addgene:62196, 62197) targeting the human CLYBL intragenic safe harbor locus between exons 2 and 3 (as was described previously (Tian et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... was randomly integrated in the genome of the target cell line via lentiviral transduction of a modified version of pHR-SFFV-dCas9-BFP-KRAB (Addgene plasmid # 46911) carrying a P2A blasticidin selection and UCOE element (kind gift of Marvin Tanenbaum) ...
-
bioRxiv - Cell Biology 2020Quote: ... Constructs for CRISPR/Cas9-mediated genome editing experiments expressing Cas9 and gRNAs were generated by cloning into pSpCas9(BB)-2A-Puro (PX459) vectors (Addgene plasmid #48139). Constructs were verified by Sanger sequencing.
-
bioRxiv - Genomics 2022Quote: ... In order to integrate CRISPR targets and sgRNAs into the genome, we modified the CROPseq vector (Datlinger et al., 2017) (Addgene ID 86708), which expresses an sgRNA and a PolII transcript ...
-
bioRxiv - Cell Biology 2019Quote: ... Lztfl1-/- cells (Figure S2) were obtained by genome editing of immortalized wild type MEFs using guide (gMS04: GCTCGATCAAGAAAACCAAC) cloned into pLentiCrisprV2 (Addgene plasmid # 52961) (Sanjana et al. ...
-
bioRxiv - Genomics 2022Quote: ... the genome-wide CRISPR-Cas9/KO Toronto Knockout version 3 library from Hart and team (Hart et al., 2017) (Addgene no. 90294), cloned into the 1 vector system (lentiCRISPRv2 carrying Cas9 and sgRNA expression on the same vector ...
-
bioRxiv - Synthetic Biology 2023Quote: The genes gabT and gabP were deleted from the EcN genome using the pSIJ8 plasmid (Jensen et al. 2016) containing the lambda Red recombineering system and ampicillin resistance (Addgene plasmid #68122). The plasmid was transformed into EcN via electroporation ...
-
bioRxiv - Systems Biology 2021Quote: ... human knockout CRISPR v1 library (Addgene #67989) (39) ...
-
bioRxiv - Microbiology 2021Quote: The human CRISPR Brunello library (Addgene 73178) (16 ...
-
bioRxiv - Neuroscience 2022Quote: ... including the human IgG1 Fc (Addgene #145165), and mouse IgG1 Fc (Addgene #28216 ...
-
bioRxiv - Cell Biology 2023Quote: ... from human pcDNA3.1-2xFLAG-SREBP1a (#26801, Addgene), pcDNA3.1-2xFLAG-SREBP1c (#26802 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Human Sin1.1 was PCR-amplified from Addgene 73388 plasmid (gift from Taekjip Ha32 ...
-
bioRxiv - Biochemistry 2024Quote: ... and recombinant human GST-CK2α (Addgene #27083) enzymes were produced in-house as previously described [30] ...
-
bioRxiv - Microbiology 2024Quote: ... The human RAB6Q72L was subcloned from Addgene plasmid #49483 into a bacteria expression pGEX-4T-1 vector encoding a N-terminal GST tag followed by a TEV cleavage site.
-
bioRxiv - Neuroscience 2021Quote: ... The BoxB reporter was pAc5.1C-Fluc-Stop-5BoxB (a gift from Elisa Izaurralde; Addgene plasmid #21301) (Behm-Ansmant et al. ...
-
bioRxiv - Cancer Biology 2023Quote: An XRN1 open-reading frame (ORF) clone deposited by Elisa Izaurralde was purchased from Addgene (#66596). The entire ORF was sequenced to confirm fidelity to the NCBI Reference Sequence NM_019001.5 ...
-
bioRxiv - Biochemistry 2020Quote: ... H-HCF-1) and full length human THAP11 cDNA with carboxy-terminal FLAG tag (Plasmid #28020; F-THAP11) were obtained from Addgene. Vectors containing full length human THAP1 cDNA with carboxy-terminal 1X FLAG tag (THAP1-F ...
-
bioRxiv - Cell Biology 2021Quote: ... The constitutively active form of kinesin-1 (human KIF5B, K560) was cloned by PCR from pet17-K560-GFP_His (Addgene, 15219) into pEGFP-N1 vector using EcoRI primer (104-5p EcoRI-K560 ...
-
bioRxiv - Cell Biology 2020Quote: ... and FLAG-tagged FL human TSC2 (1807 amino acids, UniProtKB/Swiss-Prot accession number P49815- 1) were purchased from Addgene, and pRK7 was subcloned with FLAG-tagged human TBC1D7 (293 amino acids ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... A human elongation factor 1 (EF1) promoter was introduced using a Gateway att4-att1 Entry clone (Addgene, Watertown, MA, #162920). Final expression clones were verified by restriction analysis and maxiprep DNA was prepared using the Qiaprep Maxiprep kit (Qiagen ...
-
bioRxiv - Cancer Biology 2023Quote: ... we designed single guide RNAs to target the exon 1 of the human Per2 gene and subcloned it into the PX459 vector (Addgene) to obtain the PX459-Per2 plasmid ...
-
bioRxiv - Genetics 2024Quote: ... pLenti-CMV-HA-HHIP lentiviral expression plasmid was generated by subcloning the appropriate human HHIP cDNA PCR fragment into pLenti-CMV Blast (659–1) (Addgene). HA-tag was inserted into human HHIP cDNA after Ala 23 ...
-
bioRxiv - Cell Biology 2020Quote: Stably Cas9-expressing HepG2 cells were transduced with genome-wide lentiviral pooled CRISPR/Cas9 knockout library (Addgene #73178) (Brunello; Cat# 73178-LV) (Addgene, Inc., Watertown, MA) containing 76,441 sgRNAs ...
-
bioRxiv - Cancer Biology 2022Quote: Paired mouse genome-scale CRISPR-Cas9 screening libraries (M1/M2) were provided by Shengqing Gu and Xiaole Shirley Liu (Addgene Pooled Library #1000000173). The M1 and M2 libraries cover protein coding genes of the genome with a total of 10 guide RNAs per gene ...
-
bioRxiv - Cell Biology 2023Quote: ... or a modified version of the mouse genome (GRCm38/mm10) containing the mRNA sequence for tdTomato from the ROSA-Ai9 targeting vector (#22799, Addgene, Watertown, MA, USA) to facilitate identification of GLASTAi9 cells in the scRNA-seq datasets.
-
bioRxiv - Cell Biology 2022Quote: ... having N of human coronavirus OC43 and pGBW-m4134901 (plasmid number 151922) having N of human coronavirus HKU1 229E were obtained from Addgene. Those N expression vectors were subcloned into pcDNA3.1 with C-terminal flag or EGFP tag ...
-
bioRxiv - Cancer Biology 2022Quote: ... encoding human KDM6A with HA tag and pCS2-UTX-F-MT2 (40619) encoding enzyme-dead human KDM6A were purchased from Addgene. The HR and NHEJ reporter plasmids were kind gifts from Tomasz Skorski (61) ...
-
bioRxiv - Cancer Biology 2021Quote: The human MYC cDNA was purchased from Addgene (pDONR223_MYC_WT ...
-
bioRxiv - Molecular Biology 2019Quote: ... and a human codon-optimized Cas9 (Addgene 41815) were co-nucleofected into target cells by nucleofection (Lonza apparatus) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human ETV1 (Addgene, Cambridge, MA, USA; plasmid #82209) and ETV5 (Horizon Discovery ...
-
bioRxiv - Biochemistry 2020Quote: Plasmids encoding human full-length WDR5 (2GNQ, Addgene) or a 20aa N-terminal truncation (ΔN20 ...
-
Nonsense Mediated RNA Decay Is a Unique Vulnerability of Cancer Cells with SF3B1 and U2AF1 MutationsbioRxiv - Cell Biology 2021Quote: Human GeCKOv2 CRISPR knockout pooled library (Addgene # 1000000049) and lenti-Cas9 plasmid were obtained from addgene (Addgene # 52962) ...
-
bioRxiv - Neuroscience 2021Quote: Heterologous expression of human NaV1.2 WT (Addgene #162279)(DeKeyser et al. ...
-
bioRxiv - Cancer Biology 2021Quote: ... human TERT (LOX-TERT-iresTK; Addgene plasmid #12245), generously provided by Didier Trono ...
-
bioRxiv - Neuroscience 2022Quote: ... Human VAC14 was obtained from Addgene (Plasmid #47418) and subcloned into the mCherry- C1 vector ...
-
bioRxiv - Biochemistry 2022Quote: ... Human BIN1-EGFP (isoform 8) (Addgene plasmid #27305) was cloned in pET15b with N-terminal 6xHis and C-terminal StrepII tags ...
-
bioRxiv - Microbiology 2023Quote: The human SAM CRISPRa sgRNA library (Addgene #1000000078) was cloned into the pHW-TRPPC-NS rescue plasmid backbone for PR8 (Fig S2A ...
-
bioRxiv - Biophysics 2023Quote: Human MeCP2 in the pTXB1 plasmid (Addgene #48091) was propagated in E ...
-
bioRxiv - Immunology 2023Quote: A lentiviral construct containing human ACE2 (Addgene 155295) or mScarlet (Addgene 85044 ...
-
bioRxiv - Physiology 2023Quote: ... containing human Fis1 gene were purchased from Addgene. The working viral vectors were constructed from these two plasmids by Custom DNA Constructs ...
-
bioRxiv - Biochemistry 2023Quote: Human BIN1-EGFP (isoform 8) (Addgene plasmid #27305) and human dynamin2 C-terminally tagged to mCherry were cloned in pET15b with an N-terminal 6xHis and a C-terminal StrepII tag ...