Labshake search
Citations for Addgene :
201 - 250 of 515 citations for Dig 6C SAH 1a b c since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... for the c-di-GMP sensor system purchased from Addgene (#182291), the plasmid origin was substituted with the p15A ori.
-
bioRxiv - Neuroscience 2024Quote: ... mEmerald-EB3-C-20 was a gift from Michael Davidson (Addgene plasmid # 54076 ...
-
bioRxiv - Cell Biology 2024Quote: ... A donor repair template (backbone C-terminal tagging: pHD-DsRed - Addgene #51434 ...
-
bioRxiv - Biophysics 2021Quote: ... consisting of the human brain isoform B of fyn (confirmed by BLAST alignment) was a gift from Filippo Giancotti (Addgene plasmid # 16032)(Mariotti et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... this cell line was co-transfected with a 9:1 ratio of pCENP-B-Cherry (a gift from Michael Lampson; Addgene plasmid #45219) and pPGKpuro resistance plasmid ...
-
bioRxiv - Microbiology 2023Quote: ... resistance flanked by the 5’ region of VDU and part of the VDU coding sequence was prepared by PCR using the plasmid pTREX-b-NLS-hSpCas9 (a gift from Rick Tarleton, Addgene plasmid #62543) as template and the donor TcVDU84BlastFOW and donor TcVDU84BlastREV ...
-
bioRxiv - Cell Biology 2024Quote: ... Specific gRNAs against mouse Cyri-b (ex3: CACCGGGTGCAGTCGTGCCACTAGT) were cloned into the sPs-U6-gRNA-Cas9 (BB)-2A-GFP vector (Addgene Plasmid #48138) (Ran et al. ...
-
bioRxiv - Cancer Biology 2024Quote: ... the Human GeCKOv2 CRISPR Knockout Pooled Library (A+B) in the lentiGuide-Puro vector backbone (gift from Feng Zhang; Addgene Plasmid # 1000000048) was amplified and purified as directed by Addgene ...
-
bioRxiv - Cell Biology 2023Quote: ... two shRNAs targeting EZH2 (shEZH2-a: CCGGCCCAACATAGATGGACCAAATCTCGAGATTTGGTCCATCTATGTTGGGTTTTT G and shEZH2-b: CCGG CGGAAATCTTAAACCAAGAATCTCGAGATTCTTGGTTTAA GA TTTCCG TTTTTG) were designed and cloned into pLKO.1 vector (Addgene plasmid #10879) according to method by Moffat ...
-
bioRxiv - Cell Biology 2022Quote: ... and 0.34 μg of viral entry protein (SARS-CoV-2 Spike, BEI #NR-53742) or pCMV-VSVG (a gift from B. Weinberg, Addgene plasmid #8454) using 8 μl of TransIT-293 (Mirus Bio #MIR 2705 ...
-
bioRxiv - Genetics 2023Quote: ... FlpOM was generated by introducing the human b-globin intron from CreM into a codon optimized Flp (Raymond and Soriano, 2007; Addgene plasmid # 13792), interrupting the coding sequence between amino acids 159 and 160 ...
-
bioRxiv - Cell Biology 2020Quote: Addgene plasmids used were: pCMV-lyso-pHluorin (RRID:Addgene_70113, gift from C. Rosenmund28), pLAMP1-mCherry (RRID:Addgene_45147 ...
-
bioRxiv - Biochemistry 2022Quote: ... mEmerald-JUP-C-14 (Addgene plasmid # 54132; http://n2t.net/addgene:54132; RRID:Addgene_54132) and mEmerald-Beta-Catenin-20 (Addgene plasmid # 54017 ...
-
bioRxiv - Neuroscience 2020Quote: ... (2) AAV1-hSYN-β-Arrestin2-TEV-C-P2A-TdTomato (Addgene Cat #: 89873), (3 ...
-
bioRxiv - Cell Biology 2022Quote: mEmerald-Zyxin-C-14 construct (Addgene # 54318; a gift from Michael Davidson) was cloned into the lentiviral vector pLL5.0 (Vitriol et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... mPA-GFP-MyosinIIA-C-18 was a gift from Michael Davidson (Addgene plasmid # 57149 ...
-
bioRxiv - Neuroscience 2024Quote: ... c-Myc-5-HT2A was a gift from Javier Gonzalez-Maeso (Addgene plasmid # 67944 ...
-
bioRxiv - Cell Biology 2023Quote: ... hNHE1-HA (3X on c-terminal) (pYN4+, #78715) was originally from Addgene with D720G mutation ...
-
bioRxiv - Plant Biology 2022Quote: ... StTGA2.3 was fused with a C-terminal mTagBFP2 (from Addgene plasmid # 102638)74 blue fluorescent protein (BFP ...
-
bioRxiv - Systems Biology 2022Quote: ... the PINK1 insert was derived from pCMVTNT-PINK1-C-Myc (Addgene, #13314) and the mNeonGreen insert was obtained as cDNA (Allele Biotech ...
-
bioRxiv - Neuroscience 2024Quote: ... C-terminally GFP-tagged Mannosidase cDNA was obtained from Addgene (plasmid #160905) and used without additional subcloning ...
-
LRBA balances antigen presentation and T-cell responses via autophagy by binding to PIK3R4 and FYCO1bioRxiv - Immunology 2024Quote: ... pVitro-hygro-N-myc-hVps34/Vps15-C-V5-his-plasmid (Addgene #24055), pEGFP-Atg14L (Addgene #21635 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2020) were deleted of their hygromycin B resistance gene via Lipofectamine transfection of a plasmid expressing FlpE (Addgene #20733; (Beard et al. 2006)) ...
-
bioRxiv - Cancer Biology 2023Quote: HT29 dCas9-VP64 clone E cells were transduced with lentivirus of Calabrese pooled human CRISPRa library set A and B (Addgene, 92379 and 92380) separately ...
-
bioRxiv - Cell Biology 2020Quote: The GeCKO V2 human library A and B containing 112417 sgRNAs targeting 19052 genes as well as 1000 nontargeting control sgRNAs was obtained from Addgene (Cat.# 1000000048 and 1000000049). Plasmid DNA was amplified and lentivirus was produced and amplified using HEK293FT cells following the provided protocol (51) ...
-
bioRxiv - Biophysics 2020Quote: ... The plasmid MCherry-Actin-C-18 was a gift from Michael Davidson (Addgene plasmid # 54967 ...
-
bioRxiv - Biophysics 2022Quote: ... The plasmid MCherry-Actin-C-18 was a gift from Michael Davidson (Addgene plasmid 54967 ...
-
bioRxiv - Immunology 2021Quote: ... mApple-CD36-C-10 was a gift from Michael Davidson (Addgene plasmid # 54874). The pET23a vector ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... GC-C was then cloned into the lentiviral transfer vector pUltra (Addgene #24129) between the XbaI and BamHI restriction sites by Gibson Assembly ...
-
bioRxiv - Cell Biology 2023Quote: ... The plasmid MCherry-Actin-C-18 was a gift from Michael Davidson (Addgene plasmid 54967 ...
-
bioRxiv - Cancer Biology 2024Quote: ... C-terminally FLAG-tagged ASXL1 p.G646Wfs*12 and p.Y591X were obtained from Addgene. The MSCV-T2A-Puromycin vectors encoding 3xFLAG-tagged full-length ASXL1 and truncated ASXL1 were generated by PCR amplification followed by sub-cloning using Gibson assembly.
-
bioRxiv - Cell Biology 2024Quote: Plk1 FRET sensor c-jun substrate was a gift from Michael Lampson (Addgene plasmid #45203 ...
-
bioRxiv - Molecular Biology 2024Quote: A pET28b plasmid encoding C-terminal 6xHis-tagged nuclear Pif1 (Addgene plasmid #65047)64 was employed to express and purify Pif1 from E ...
-
bioRxiv - Biochemistry 2022Quote: ... yeast expression vector while HsTOP2β was inserted into the 12URA-C (Addgene #48305) yeast expression vector using Ligation Independent Cloning (LIC) ...
-
bioRxiv - Cancer Biology 2024Quote: ... LR reaction was performed to clone BRPF1 into pLEX_305-C-dTAG (Addgene #91798). PAM sequence adjacent to the BRPF1 sgRNA #1 was changed from NGG to NAG to ensure that the overexpression construct will not be knocked out by CRISPR/Cas9 ...
-
bioRxiv - Neuroscience 2024Quote: ... We employed the rat stargazin C-terminus (residues 203-323) (Addgene plasmid # 80406) [60] with three phosphomimetic mutations (S239D ...
-
bioRxiv - Biophysics 2024Quote: ... or only a C-terminal SNAP tag (NVD005, to be deposited on Addgene). PurExpress parts A and B were incubated for either 45 minutes or overnight at 4°C before combining with at least 100 ng of template ...
-
bioRxiv - Biochemistry 2024Quote: ... HeLa or XP-C cells were transiently transfected with pX330-mCherry (Addgene, 98750) or pX459-puromycin (Addgene ...
-
bioRxiv - Microbiology 2020Quote: ... a total of 300 million Huh7.5.1-Cas9 cells were then separately transduced with the lentiviral gRNA sublibraries A and B of the human GeCKO v2 library (Addgene #1000000049, gift from Feng Zhang) at a multiplicity of infection (MOI ...
-
bioRxiv - Biochemistry 2022Quote: ... the mNeonGreen gene was amplified from a pCS2+mNeonGreen-C Cloning Vector (Addgene #248605) using design primers (Supplementary Table 3) ...
-
bioRxiv - Cancer Biology 2022Quote: ... RPE1 hTERT cells were retrovirally infected with pBABE c-Myc-ER plasmid (Addgene, 19128), infected cells were selected in 5μg/ml puromycin and the surviving polyclonal population was used in further assays ...
-
bioRxiv - Cell Biology 2022Quote: ... and pcDNA3.1-STIM1-Venus-173-C (a gift from Jin Zhang; Addgene plasmid #87619), respectively ...
-
bioRxiv - Molecular Biology 2021Quote: The sfGFP-H2B reporters were constructed from the plasmid sfGFP-H2B-C-10 (Addgene 56367 ...
-
bioRxiv - Cell Biology 2021Quote: ... Either a control vector (c-Flag pcDNA3 was a gift from Stephen Smale (Addgene plasmid #20011 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... C-terminal His-tagged eGFP plasmid was from our lab stock (Addgene, No. 178422)32 ...
-
bioRxiv - Plant Biology 2024Quote: ... for C-terminal fusions we used pGADCg and pGBKCg (gift from Peter Uetz, Addgene plasmids #20161 ...
-
bioRxiv - Cell Biology 2023Quote: ... or a pcDNA3.1-based plasmid containing a C-terminal 3xFLAG-V5 tag (Addgene 87063) for all other variants ...
-
bioRxiv - Neuroscience 2024Quote: ... Each double strand was subsequently cloned using EcoRI and AvrI sites in the pDIO-DSE-mCherry-PSE-MCS vector (Addgene; #129669; a gift from B. Rico41).
-
bioRxiv - Cell Biology 2020Quote: ... mEmerald-N-Wasp-C-18 and mEmerald-Coronin1B from Michael Davidson (Addgene plasmids #54199, 54050), pmCherry-C1-WIP from Anna Huttenlocher ...
-
bioRxiv - Cancer Biology 2020Quote: ... HPV16 E7 (p6640 MSCV-P C-FlagHA 16E7-Kozak - Addgene plasmid # 35018 – Dr. Peter Howley). HPV16 E6E7 (pLXSNE6E7 Addgene#52394 – Dr ...