Labshake search
Citations for Addgene :
201 - 250 of 2708 citations for 7 Chloro 2 hydrazino 5 phenyl 3H 1 4 benzodiazepine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: Stereotaxic injection of AAV-EF1a-DIO-HChR2(H134R)-eYFP (serotype 2/1 or 2/9, U. Penn Vector Core, Philadelphia, PA, USA or Addgene, Watertown, MA, USA) was performed in 6-8 weeks old DAT-IRES-Cre or FoxP2-Cre transgenic mice ...
-
bioRxiv - Genomics 2022Quote: ... Each 15-cm2 plate was transfected with a total of 21 μg of plasmid DNA (1:2:1 ratio psPAX2-D64V:pLenti-STARR:pLAI-Env) [psPAX-D64V (Addgene #63586), and pLAI-HIV (Addgene #133996)] ...
-
bioRxiv - Neuroscience 2024Quote: ... The he1.1:YFP cassette (he1.1:YFP_F, he1.1:YFP_R, Table 4) was amplified from p3E_he1a:YFP (Addgene, plasmid #113879), and the polyA terminator (polyA_F ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.25 µL of EnvA G-Deleted Rabies-mCherry (diluted 1:5 in dPBS; Addgene: 32636) was injected in the basal forebrain using the same coordinates ...
-
bioRxiv - Cell Biology 2020Quote: ... and pT7-7 α-Syn A53T (Addgene plasmid #10572737; http://n2t.net/addgene:105727; RRID:Addgene_105727) (gift from Hilal Lashuel).
-
bioRxiv - Neuroscience 2022Quote: ... we injected AAV1-CAG-FLEXFRT-ChR2(H134R)-mCherry (75470, 7×1012 vg/mL, Addgene). For imaging DA dynamics ...
-
bioRxiv - Biophysics 2022Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid 54920 ...
-
bioRxiv - Cell Biology 2019Quote: ... mEmerald-Vimentin-7 and F-tractin-EGFP were gifts from Michael Davidson (Addgene; 54299) and Dr ...
-
bioRxiv - Biophysics 2022Quote: ... mApple-Lifeact-7 (denoted Lifeact-mApple here) was a gift from Michael Davidson (Addgene plasmid # 54747 ...
-
bioRxiv - Developmental Biology 2019Quote: ... Nslmb-vhhGFP4 coding sequence was amplified from pcDNA3-NSlmb-vhhGFP4 (Addgene plasmid #35579, (7)) by PCR and cloned into pCS2+ plasmid by Gibson assembly.
-
bioRxiv - Cell Biology 2020Quote: Plasmids for the expression of recombinant α-Syn were: pT7-7 α-Syn (Addgene plasmid #3604636 ...
-
bioRxiv - Biophysics 2020Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid # 54920 ...
-
bioRxiv - Neuroscience 2021Quote: ... or AAV5-hSyn-eGFP (titer ≥ 7×1012 vg/mL; Addgene viral prep #50465-AAV5) as control ...
-
bioRxiv - Microbiology 2022Quote: Several plasmids were a kind gift from Nevan Krogan [7] (ORF8-Strep (Addgene #: 141390), Spike-Strep ...
-
bioRxiv - Cell Biology 2023Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid 54920 ...
-
bioRxiv - Bioengineering 2023Quote: ... An existing plasmid was used for the expression of all 7 chaperones (Addgene #197589). For generating the DRUM or DRUMmut stable cell lines ...
-
bioRxiv - Neuroscience 2023Quote: ... Approximately 0.2uL of pAAV5-hSyn-hM4D(Gi)-mCherry (≥ 7 x 1012vg/mL, Addgene # 50475), pAAV5-hSyn-mCherry (≥ 7 x 1012vg/mL ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAV-hSyn-DIO-mCherry (400 nl at titer 7×1012, Addgene, #50459-AAV5) as control ...
-
bioRxiv - Neuroscience 2020Quote: Raphe and RTN glia AAV-5: pZac2.1 gfaABC1D-cyto-GCaMP6f at a titre of 1×1013 GC·ml-1 (Addgene, Watertown, MA, USA).
-
bioRxiv - Microbiology 2021Quote: Chemical-genetic screens were initiated by thawing 5 × 1 mL (1 OD600 unit per mL) aliquots of the Mtb CRISPRi library (RLC12; Addgene #163954) and inoculating each aliquot into 19 mL 7H9 supplemented with kanamycin (10 μg/ml ...
-
bioRxiv - Neuroscience 2023Quote: ... were coated with 200 nL of a 1:1 mixture of 5% silk fibers and AAV9.CaMKII.GCaMP6f.WPRE.SV40 (Addgene viral prep # 100834-AAV9), as previously described by 70 ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAV8-hSyn-DIO-GFP (Addgene, n=8, 4 male, 4 female) were injected bilaterally into the BNST (5 × 1012 titer ...
-
bioRxiv - Cancer Biology 2020Quote: WM266-4 or SK-MEL-2 cells were co-transduced with conditioned media containing lentiviruses bearing Firefly luciferase-7TFP (Addgene #24308, β-catenin reporter) and Renilla luciferase pLenti.PGK.blast-Renilla Luciferase (Addgene #74444 ...
-
bioRxiv - Cell Biology 2022Quote: ... Dynamin 2-mTFP1 (or dynamin 1-mTFP1) construct was created by replacing the EGFP tag of dynamin 2-EGFP (or dynamin 1-EGFP, Addgene) with mTFP1 (Addgene) ...
-
bioRxiv - Bioengineering 2022Quote: ... Each shRNA was cloned into the host pLKO.1-puro vector. PLKO-shFOXA1#1 (Cat. #: 70095) and PLKO-shFOXA1#2 (Cat. #: 70096) were obtained from Addgene, and previously used 45 ...
-
bioRxiv - Cell Biology 2023Quote: PARP-1 sgRNAs (#1, GTGGCCCACCTTCCAGAAGC; #2, ATACCAAAGAAGGGAGT-AGC) were synthesized and subcloned into lenti-CRISPR vector (Addgene, pXPR_001, plasmid 49535). Lentiviral vectors were co-transfected into HEK293FT cells with the lentivirus packaging plasmids pVSVg and psPAX2 using FuGENE® HD ...
-
bioRxiv - Microbiology 2021Quote: ... 4-363h21C1 and 3-978h1C1 and were cloned into lentiviral vector pLKO.1-puro (Addgene, catalogue #8543). Lentiviral vectors were produced in 293T cells by Fugene transfection and the supernatant was used to infect Jurkat cells ...
-
bioRxiv - Neuroscience 2023Quote: 1-4 evenly spaced ∼60 nl injections of the AAV1-synapsin-l-GCamp6f (Addgene, MA stock #100837) that had been diluted to a titer of ∼1×10^12 vg/mL using sterile PBS were made in each cranial window ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV8-hSyn-DIO-hM4D(Gi)-mCherry (Addgene, n=8, 4 male, 4 female) or AAV8-hSyn-DIO-GFP (Addgene ...
-
bioRxiv - Neuroscience 2020Quote: ... the target sequence (5’-GGGTGAAGATCCTGTTCAATA-3’) was shuttled to the pLKO.1-Hygromycin vector (Addgene, #24150). For human astrocytes ...
-
bioRxiv - Neuroscience 2022Quote: ... mice were infused with diluted (1:5) or undiluted virus pAAV5-CAMKIIa-(hChR2- H134R)-eYFP (Addgene-ChR2 titre ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLKO.1 and pLKO.5 were sourced from Addgene (#1864; a gift from David Sabatini 9) and Sigma-Aldrich (St ...
-
bioRxiv - Neuroscience 2021Quote: ... 200 nL of AAVrg-hSyn-GFP (Addgene 50465-AAVrg; titer 7×10^12 vg/mL) was injected unilaterally at a rate of 2nL/sec ...
-
bioRxiv - Neuroscience 2022Quote: ... or pAAV-hSyn-DIO-mCherry (Control mCherry reporter; Addgene #50459, titers: 7×1012 vg/ml) into the VTA ...
-
bioRxiv - Cell Biology 2020Quote: ... the GFP11x7 cassette was PCR amplified from pACUH:GFP11×7-mCherry-beta-tubulin (Addgene, plasmid # 70218), and integrated at the 5’ end of the SHE1 open reading frame using the sequential URA3 selection/5-FOA counterselection method ...
-
bioRxiv - Neuroscience 2021Quote: ... pAAV-hSyn-hM4D(Gi)-mCherry (serotype AAV retrograde, viral titer ≥ 7×1012 vg/mL; Addgene), and Clozapine N-oxide (CNO ...
-
bioRxiv - Cell Biology 2023Quote: Expression constructs used in this study include pCI-mScarlet (Addgene #85042; pC1-mScarlet-Syp [7]), pCIG2-GFP-MACF43 [42] ...
-
bioRxiv - Genomics 2023Quote: ... 7 μg of pUCmini-iCAP-PHP.eB (a gift from Viviana Gradinaru, Addgene plasmid #103005, RRID:Addgene_103005)24 ...
-
bioRxiv - Genomics 2023Quote: ... 7 μg of pUCmini-iCAP-PHP.eB (a gift from Viviana Gradinaru, Addgene plasmid #103005, RRID:Addgene_103005)24 ...
-
bioRxiv - Neuroscience 2023Quote: ... and AAV5-hSyn-DIO-hM4D(Gi)-mCherry (Addgene #44362; virus titer ≥ 7×10¹² vg/mL) viruses were performed on adult anesthetized (isoflurane ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV-hSyn-DIO-hM3D(Gq)-mCherry (400 nl at titer 7×1012, Addgene, #44361-AAV5) for activation ...
-
bioRxiv - Neuroscience 2024Quote: ... and 0.1 µL of AAV2-pCAG-FLEX-eGFP (Addgene #51502; titer: 7×10¹² vg/mL) was injected into the SNr during the same surgery ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/5: pAAV2/5 was a gift from Melina Fan (Addgene plasmid # 104964 ...
-
bioRxiv - Neuroscience 2021Quote: ... were added to each well along with 1 μl of Syn1-EBFP-Cre (serotype, 2-1; titer, 6×1012 genomes/mL; MOI, ∼8-0.08; Addgene, 51507-AAV1) delivered at full strength or diluted 1:103-104 ...
-
bioRxiv - Neuroscience 2023Quote: We used AAV1-hSyn-GCaMP6f (2 × 1013 vg/mL Penn Vector Core/Addgene; diluted 1:8 to 1:15 in saline) for experiments involving two-photon calcium imaging of V1 layer 2/3 cells ...
-
bioRxiv - Neuroscience 2024Quote: ... Pups were injected unilaterally with 1 μl of AAV9-hSyn-DIO-ChrimsonR-mRuby2-ST (2 × 1012 gc ml−1; Addgene #105448) or 1 μl of AAV9-CAG-Flex-ArchT (2 × 1012 gc ml−1 ...
-
bioRxiv - Microbiology 2022Quote: ... 500 ml LB culture of pCDFDuet-1-6×His-SARS-CoV-2-NSP7/NSP8 (Addgene)-transformed E.coli BL21 DE3 strain was induced by isopropyl β-d-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Biochemistry 2023Quote: ... coli BL21 (DE3) cells using the plasmid pRSFDuet-1/CylLL/CylM-2 (Addgene ID #208759), following the method previously reported.9 For the preparation of lanthionine standard ...
-
bioRxiv - Biochemistry 2024Quote: ... two all-in-one CRISPR-Cas9 vectors were generated from pX330A-1×2 (58766, Addgene) and pX330S-2-PITCh (63670 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4 μg pUMVC (Addgene, 8449) and 18 μg transfer plasmid were mixed in 700 μL DMEM medium (Corning ...