Labshake search
Citations for Addgene :
201 - 250 of 690 citations for 6 CHLOROPURINE RIBOSIDE 5' O MONOPHOSPHATE SODIUM SALT since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... RB1 and TP53 sgRNA sequences highlighted in Supplementary Table 6 were cloned in a LentiCRISPRv2 (Addgene # 52961) backbone (47) ...
-
bioRxiv - Microbiology 2024Quote: ... Guide RNAs targeting exon 6 of Akr1c13 were cloned into pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene #42230). A T7-sgRNA PCR product was amplified and in vitro transcribed as previously described (65 ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... for the Right Arm (5’-TACATCCCTAAGGCCTGATTACCCGAACACT-3’, 5’-TATACGCGTTGCCATGCTATTGGCTTC-3’) and cloned into pHD-DsRed-attp (Gratz et al., 2014; Addgene Plasmid # 51019) in two steps ...
-
bioRxiv - Cancer Biology 2019Quote: ... Pfeiffer CRISPRi cells (2×108) were transduced with the top 5 half library of hCRISPRi_v2 (Addgene #83969, i.e. 5 sgRNAs per gene) at an MOI of 0.3 in 200 mL culture medium + 8 μg/mL polybrene in 2× 225 cm2 cell culture flasks ...
-
bioRxiv - Cancer Biology 2019Quote: ... GDI2 (crGDI2-1 Fw 5’ GCCACCCGAGTCAATGGGGA 3’ and crGDI2-2 Fw 5’ CACTCTCTCCTCCGTACGTA 3’) into a lentiviral CAS9 expressing plasmid (Addgene Plasmid # 49535) using the BSMB1 restriction sites ...
-
bioRxiv - Cell Biology 2021Quote: ... human MCOLN1 was amplified by PCR with the following oligonucleotides with overhangs (underlined): 5’-GACACCGACTCTAGAATGGTGAGCAAGGGCGAGGAGC-3’ (forward) and 5’-AACTAGTCCGGATCCTCAATTCACCAGCAGCGAATGC-3’ (reverse) from Mucolipin1-pEGFP C3 (Addgene plasmid #62960) construct and subcloned into XbaI and BamHI restriction sites of pLenti-CMV-MCS-GFP-SV-puro (Addgene plasmid #73582 ...
-
bioRxiv - Neuroscience 2020Quote: ... each given at a total volume of 0.8 μl per hemisphere: 1) inhibitory Gi DREADD (AAV5-hSyn-hM4Di-mCherry; UNC Vector Core; n = 5; AAV8-hSyn-hM4Di-mCherry; Addgene; n = 5); excitatory Gq DREADD (AAV8-hSyn-hM3Gq-mCherry ...
-
bioRxiv - Cancer Biology 2020Quote: ... The sgRNA pairs were manually selected from the output list and cloned into the pGECKO backbone (CRISPRi.1: 5’ GTTACTTCCAACGTACCATG 3’, CRISPRi.2: 5’ CCTGTACCCCCATGGTACGT 3’) (Addgene 78534; (68))
-
bioRxiv - Cancer Biology 2021Quote: ... by introducing one or two guide RNAs (5′-GTTGGCTCGCCGGATACGGG-3′ for H3f3b; 5′-ACTCCAGTCTTTCTAGAAGA-3′ for Rosa26) into LentiCRISPR v2 (Addgene plasmid #52961) and LentiCRISPRv2 hygro (Addgene Plasmid #98291) ...
-
bioRxiv - Neuroscience 2022Quote: ... GAD2-IRES-Cre mice were injected in the ZI with a 5:1 mix of AAV2/5-hSynapsin1-Flex-axon-GCaMP6s (Addgene, #112010-AAV5) and AAV2/9-FLEX-tdTomato (Addgene ...
-
bioRxiv - Neuroscience 2020Quote: ... 1:5 dilution in saline solution) or AAV1.CAG.DIO.tdTomato (control, 120 nl, 2.6×1013 vg/mL Addgene, diluted 1:5 in saline) was injected into AL ...
-
bioRxiv - Cell Biology 2022Quote: A sgRNA construct targeting exon 2 of the human ACLY gene was made by inserting annealed, phosphorylated oligonucleotides (5′-CACCGGAATCGGTTCAAGTATGCTC-3′, 5′-AAACGAGCATACTTGAACCGATTCC-3′) into pSpCas9(BB)-2A-Puro (PX459, Addgene, plasmid 48139). The sgRNA construct was then transfected (2 μg ...
-
bioRxiv - Systems Biology 2019Quote: ... we performed inverse PCR using F primer (5’-TGAGCGGCCGCTAGGTACCTTTAA-3’) and R primer (5’-GGCACCGGGCTTGCGGGTCATGCA-3’) and pKLV-U6gRNA-EF(BbsI)-PGKpuro2ABFP (Addgene, Plasmid #62348) as a template ...
-
bioRxiv - Microbiology 2020Quote: ... targeting ACE2 (5’-TGGATACATTTGGGCAAGTG −3’) and one targeting B4GALT7 (5’-TGACCTGCTCCCTCTCAACG-3’) was cloned into the lentiGuide-Puro plasmid (Addgene plasmid #52963) following published procedure (Sanjana et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... The fragment has been amplified using the primers F-5’-TGCAGGATCCCATCGATTCGGCCACCATGAAACGGACAG -3’ and R-5’-TAGAGGCTCGAGAGGCCTTGTCAGACTTTCCTCTTCTTCTTGG -3’) from the pCAG-CBE4max-SpG-P2A-EGFP plasmid (Addgene plasmid #139998)14 and from the pCAG-CBE4max-SpRY-P2A-EGFP plasmid (Addgene plasmid #139999)14.
-
bioRxiv - Genetics 2020Quote: ... oligonucleotides for gRNA synthesis (5’ TAGGAGGAAACTGTGCTCTTCA 3’ and 5’ AAACTGAAGAGCACAGTTTCCT 3’) were annealed and ligated into plasmid pDR274 (Addgene #44250, Watertown, MA). Purified plasmid DNA was digested with DraI (New England BioLabs ...
-
bioRxiv - Immunology 2023Quote: ... Next the LentiGuide-Puro plasmid [49] was used to express a single-guide RNA (CD58 sgRNA; 5’-GAGCATTACAACAGCCATCG-3’ and ICAM4 sgRNA: 5’-CCGGGAACACCTGCGTCACG-3’) LentiGuide-Puro (Addgene plasmid # 52963) was a gift from Feng Zhang ...
-
bioRxiv - Molecular Biology 2024Quote: ... The insert containing CGG repeats within the 5’UTR of FMR1 gene fused with EGFP sequence was derived from 5’UTR CGG 99x FMR1-EGFP (Addgene plasmid #63091). The insert was ligated into the vector instead of EGFP sequence ...
-
bioRxiv - Microbiology 2024Quote: The viral 5′UTR reporter constructs were synthesized using GeneArt and cloned into pLV-SARS-CoV-2 5′UTR-Luciferase (Addgene Cat#191480)32 using NdeI and BsaBI ...
-
bioRxiv - Cancer Biology 2019Quote: ... and pLenti PGK GFP Puro (w509-5) (Addgene 19070) were gifts from Eric Campeau & Paul Kaufman ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV2/5-gfaABC1D-tdTomato was purchased from AddGene (44332).
-
bioRxiv - Neuroscience 2021Quote: ... AAV 2/5 hSyn-GCaMP6f was purchased from Addgene (Cat # 100837-AAV ...
-
bioRxiv - Neuroscience 2021Quote: ... with sgRNA (5’-CTTGTGGGGTCA-TGGTTTACAGG-3’) plasmid (Addgene, 68463), Cas9 plasmid ...
-
bioRxiv - Cell Biology 2021Quote: ... with 5 µg of Cas9-GFP plasmid (Addgene, 44719), 5 µg of sgRNA and 5 µg of ssDNA donor template (Table S1 ...
-
bioRxiv - Cell Biology 2019Quote: ... using vector sequence derived from LV1-5 (Addgene #68411) and cDNAs of SURF4 and Katushka2S (a gift from Gary Luker(100)) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 5 μg of either H2B-GFP (Addgene #11680) or H2B-RFP (Addgene #26001 ...
-
bioRxiv - Systems Biology 2023Quote: ... The CRISPRi-v2 (5 sgRNA/TSS, Addgene: Cat#83969) sgRNA library was transduced into Jurkat cells at an MOI < 0.3 (BFP+ cell percentages were ∼30%) ...
-
bioRxiv - Cell Biology 2022Quote: ... and 5 µg packaging plasmid pUMVC (Addgene, Plasmid #8449). Virus particles were collected 48 h after transfection ...
-
bioRxiv - Neuroscience 2023Quote: ... Cre- dependent AAV2/5 hSyn.DIO.hM4D(Gi)-mCherry (Addgene; #44362) expressing the inhibitory hM4Di designer receptor exclusively activated by designer drugs (iDREADD ...
-
bioRxiv - Genetics 2023Quote: ... a fli1 P-5’entry clone (Addgene, Lawson Lab), an EGFP p-middle entry (Addgene ...
-
bioRxiv - Genetics 2023Quote: ... a fli1 P-5’entry clone (Addgene, Lawson Lab), an EGFP p-middle entry (Addgene ...
-
bioRxiv - Genetics 2023Quote: ... a fli1 P-5’entry clone (Addgene, Lawson Lab), an EGFP p-middle entry (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: 5×NF-κB_RE::RedF (#124530; Addgene, Watertown, MA, USA) is the reporter plasmid consisting of a red firefly luciferase driven by a minimal promoter containing five NF-κB-binding sites (NF-κB-Luc ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 μg envelope helper plasmid (pMD2.G, Addgene #12259) and 80 μl of 1mg/ml polyethylenimine (PEI ...
-
bioRxiv - Neuroscience 2023Quote: ... 2.0 μl of AAV2/5.CAG.GCaMP6s.WPRE.SV40 (titer: 1X1013; Addgene) was injected into the left trigeminal ganglion (TG ...
-
bioRxiv - Neuroscience 2021Quote: ... 6-7E6 cells were resuspended in nucleofection solution and mixed with 3ug of pCAG-EGFP plasmid (Addgene, 89684) and 600nM of siRNA ...
-
bioRxiv - Microbiology 2019Quote: ... C57BL/6 MEFs were transfected with GFP- or HA-epitope tagged ubiquitin plasmids (Addgene #11928 and #18712, respectively) 24 hours before infection ...
-
bioRxiv - Biochemistry 2020Quote: The original coding sequence for H2B:GFP was taken from pCS2-H2B:GFP plasmid (Addgene, Plasmid #53744, Supplementary Fig. 6), manually codon-optimized to minimize the occurrence of poly-Cn stretches (n<3) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The two sgRNAs targeting Dazl exon 6 were cloned into the pSpCas9(BB)-2A-GFP backbone (Addgene #48138). The knock-in led to the generation of a reporter cell line named Dazl-mScarlet-HygromycinR (DASH) ...
-
bioRxiv - Cell Biology 2020Quote: ... and ESRG (6 μg each) along with 3 μg of pMD2.G (gift from Dr. D. Trono; RRID:Addgene_12259) was transfected into PLAT-GP packaging cells ...
-
bioRxiv - Molecular Biology 2022Quote: ... Two million iPSCs were electroporated with 6 μg of CAG- Cas9-T2A-EGFP-ires-Puro (deposited in Addgene, plasmid no ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV5-CMV-EGFP (Suppl. Figs. 1A, 6 and 7D; Salk Vector Core; 2.08 x 1012; Addgene plasmid #32395); AAV9-FLEX-rev-ChR2-tdTomato (Suppl ...
-
bioRxiv - Neuroscience 2020Quote: The DNA fragment of H2B-mEos4b-6 (a gift from Michael Davidson (Addgene plasmid # 57508; http://n2t.net/addgene:57508; RRID:Addgene_57508)) and TRE (pTRE-tight vector (Clontech #631059) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Lee and Luo 1999)- with the codon optimized GAL80 sequence from pBPGAL80Uw-6 - a gift from Gerald Rubin (Addgene plasmid #26236, http://n2t.net/addgene:26236; RRID:Addgene_26236) (Pfeiffer et al ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were plated in 6-well plate and co-transfected with SBE4-Luc plasmid (1 μg, Addgene,16495) and pDEST26-Renilla plasmid (0.1 μg ...
-
bioRxiv - Developmental Biology 2023Quote: ... EGFP-Tubulin-6 was a gift from Michael Davidson (Addgene plasmid # 56450; http://n2t.net/addgene:56450; RRID: Addgene_56450). mTagBFP-Lysosomes-20 was a gift from Michael Davidson (Addgene plasmid # 55263 ...
-
bioRxiv - Genomics 2023Quote: ... All 3 of the 6 wells were transfected with 100 ng of pCAG-NLS-HA-Bxb1 (Addgene #51271) and 1,500 ng of donor attB library whereas the T25 was transfected with 1,000 ng of the Bxb1 containing plasmid and 5,000 ng attB library ...
-
bioRxiv - Cell Biology 2023Quote: ... Two million iPSCs were electroporated with 6 µg of CAG-Cas9-T2A-EGFP-ires-Puro (deposited in Addgene, plasmid no ...
-
bioRxiv - Neuroscience 2023Quote: ... neonatal Swiss Webster or C57Bl/6 (P0–3) mice were anesthetized on ice for 3 min before injecting viral vectors (AAV5.GfaABC1D.GCaMP6f.SV40 [Addgene, 52925-AAV5] ...
-
bioRxiv - Neuroscience 2023Quote: ... 6 × 107 RPE1 cells were infected with the human sgRNA library (Human GeCKO v2 Library Cat#1000000048, Addgene) at an MOI of ∼0.3 ...