Labshake search
Citations for Addgene :
201 - 250 of 3830 citations for 5R 3 4 5 6 Tetrahydro 5 phenyl N benzyloxycarbonyl 4 H 1 4 oxazin 2 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: Human Drosha isoform 4 and human DGCR8 clones were purchased from Addgene. cDNA encoding different length variants of Drosha were cloned into pFL plasmid and expressed as a N-terminal Dual-strep tag fusion ...
-
bioRxiv - Molecular Biology 2024Quote: ... lenti MS2-P65-HSF1_Hygro (4) was a gift from Feng Zhang (Addgene plasmid # 61426 ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were transfected with plasmids expressing VSV-G (4 μg; Addgene #12259), Gag-Pol (3.375 μg ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were transfected with plasmids expressing VSV-G (4 μg; Addgene #12259), Gag-Pol (3.375 μg ...
-
bioRxiv - Biochemistry 2024Quote: ... An oligonucleotide corresponding to a target sequence near the smo-1 translational start site (sgRNA #1: 5‘ GCCGATGATGCAGCTCAAGC 3‘) was cloned into the plasmid pMW46 (derivate of pDD162 from Addgene). The deletion of the eleven amino acids ADDAAQAGDNA at the SMO-1 N-terminus was achieved using the oligonucleotide pAF64 as repair template ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were transfected with 5 μg of mEmerald-Kinesin11-N-18 plasmid (Addgene number: 54137) 24 hours prior to imaging ...
-
bioRxiv - Cell Biology 2024Quote: ... and 2 (sgRNA-GALC2: 5’ TACGTGCTCGACGACTCCGA 3’) were subcloned individually into pX459 v2.0 (gift from Dr. Feng Zhang, Addgene plasmid #6298832). GALC targeting sequences were further tested by the Off-Spotter software to minimize potential off target effect ...
-
bioRxiv - Molecular Biology 2024Quote: ... a sgRNA (5’-GCTAGTGGAGAACTTGGAAA-3’) targeting the R164-allele of PCNA exon 5 was cloned into hSpCas9(BB)-2A-GFP (PX458, Addgene 48138). A double-stranded donor was constructed with a point mutation to revert the arginine (AGA ...
-
bioRxiv - Physiology 2024Quote: ... a sgRNA was designed for exon 5 of PKHD1 (5’-3’ ACTTCCTGGAAGCATACTTC) and cloned into a pX330 plasmid (Addgene plasmid, 42230). HCD cells were transfected with the sgRNA encoding plasmid and pAcGFP1-C1 plasmid using FuGENE (Promega) ...
-
bioRxiv - Cell Biology 2022Quote: ... U2OS 2-6-3 were transduced with pLenti CMV rtTA3 Blast (w756-1, plasmid #26429; Addgene, gift from E. Campeau) for the expression of rtTA ...
-
bioRxiv - Neuroscience 2024Quote: ... or the control reporter mCherry (AAV5-hsyn-DIO-mcherry, Addgene #50459 titre: 1:4 – 7×10¹² GC/mL).
-
bioRxiv - Cell Biology 2020Quote: ... an sgRNA (5’-TTGGCACGCCTCCTCAGGCA-3’) was sub-cloned into PX458 (Addgene, 48138). The C-terminal region of the CENP-E gene was amplified with the following primers ...
-
bioRxiv - Cancer Biology 2020Quote: ... or RB1 (5’-GCTCTGGGTCCTCCTCAGGA-3’) were cloned into the lentiCRISPRv2 (Addgene #52961) plasmid ...
-
bioRxiv - Cancer Biology 2024Quote: ... SEPSECS: 5’-AACCGCGAGAGCTTCGCGG-3’ were cloned into lentiCRISPRv2 vector (Addgene, Plasmid #52961) using BsmBI restriction sites ...
-
bioRxiv - Cell Biology 2024Quote: ... co-injection marker pCFJ104 (Pmyo-3-mCherry; Addgene #19328, 5 ng/µL) and marker pCFJ90 (Pmyo-2-mCherry ...
-
bioRxiv - Neuroscience 2023Quote: ... PV-cre mice received unilateral injections in the left lobule simplex of 0.7 µl of pAAV-1-hSyn1-Flex-SIO-stGtACR2-FusionRed-dlox (N = 5, 2.0 × 1012 genome copies/mL; Addgene: 105677-AAV1), while another group of PV-cre mice received injections of pAAV-9/2-hSyn1-dlox-tdTomato-dlox-WPRE (N = 3 ...
-
bioRxiv - Genomics 2022Quote: ... 1-10 µg YAC/BAC payload DNA and 2-5 µg pCAG-iCre plasmid (Addgene #89573) per transfection ...
-
bioRxiv - Cell Biology 2020Quote: ... was generated by ligating oligonucleotides containing the targeting sequence 5’-CAGTTCCTGGGTGGAGCTA-3’ into pLKO.1-puro (Addgene # 8453). The mitochondrial (CMV-mitoCAR-GECO1 ...
-
bioRxiv - Neuroscience 2023Quote: ... Suppl Fig 3: AAV9-CaMKIIa-hChR2-EYFP (1:5, Addgene viral prep #26969- AAV9; http://n2t.net.addgene:26969; RRID; Addgene:26969 ...
-
bioRxiv - Cancer Biology 2024Quote: ... The N-Terminal pFLAG 3 vector (Addgene) was employed for cloning the DCLK1 DCX DNA by restriction digest ...
-
bioRxiv - Neuroscience 2024Quote: ... polyA_R, Table 3) and plasmid backbone (Col1E_F, Col1E_R, Table 4) were amplified from pPRISM-Stop-cmlc2-eGFP (Addgene kit #1000000154; Wierson et al., 2020). The PCR-amplified fragments were assembled using NEBuilder HiFi DNA Assembly Cloning Kit (E5520S ...
-
bioRxiv - Bioengineering 2024Quote: ... the kanamycin-resistance gene AphAI flanked by an I-SceI restriction site (I-SceI-AphAI fragment) was amplified using primers 5 and 6 listed in Supplementary Table 1 from pEPkan-S (Addgene plasmid #41017 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 μg of packaging vector psPAX2 (gift from Didier Trono (Addgene plasmid # 12260)) ...
-
bioRxiv - Molecular Biology 2020Quote: ... was mixed with 4 μg of DNA RV helper plasmid (Addgene, plasmid #12371), in 1800 μl of Opti-MEM reduced serum medium (ThermoFisher ...
-
bioRxiv - Physiology 2021Quote: ... 200nL AAV-hM3D(G)q-mCherry (Addgene 44361-AAV8, 4×1012 vg/mL) was injected bilaterally at 50nl/min and mice were allowed 2 weeks recovery prior to testing ...
-
bioRxiv - Molecular Biology 2020Quote: ... cells were transfected with 0.5 μg of EGFP-PGC-1α FL (Addgene, #4) or ΔCTD for 24 h.
-
bioRxiv - Cancer Biology 2023Quote: ... 4 μg of packaging vector psPAX2 (gift from Didier Trono (Addgene plasmid # 12260), 2 μg envelope vector pMD2.G (gift from Didier Trono (Addgene plasmid # 12259 ...
-
bioRxiv - Immunology 2023Quote: ‘CD44-isoform1-CD4d3+4-bio’ plasmid was obtained from Addgene (# 73098, Watertown, MA26). The extracellular region of CD44 was PCR amplified from this construct using primers listed in Supplementary Table S3 ...
-
bioRxiv - Cell Biology 2024Quote: ... and an mEGFP plasmid with 1 kb homology arms (AICSDP-4:TUBA1B-mEGFP, Allen Institute, Addgene plasmid # 87421; RRID:Addgene_87421)41 mutated for the gRNA binding site ...
-
bioRxiv - Cancer Biology 2020Quote: ... sgFLI_Ex9 (5’-GCCTCACGGCGTGCAGGAAG-3’) was cloned into lentiCRISPR v2-Blast vector (Addgene, #83480) using BsmbI restriction sites ...
-
bioRxiv - Developmental Biology 2022Quote: ... a p21 sgRNA (5’-GATTGCGATGCGCTCATGGC-3’) was cloned into the px330 vector (Addgene). ESCs were co-transfected with 2μg of this vector and 0,12μg of an hygromycin marker (#631625 ...
-
bioRxiv - Neuroscience 2022Quote: ... unique sgRNA (5’-CACCGGGACATAGTATTTGAAAGAC-3’) was cloned into lenti-CRISPRv2 construct (Addgene #52961), which expresses Cas9 and puromycin cassette ...
-
bioRxiv - Neuroscience 2022Quote: A viral cocktail containing AAV2/5.GfaABC1D GCaMP6f (3 × 1012 gc/ml, Addgene) for astrocyte Ca2+ detection or AAV9.hSyn.GCaMP6f (3 × 1012 gc/ml ...
-
bioRxiv - Immunology 2021Quote: ... pLenti-GFP (Core with 5’ and 3’ LTR) was also from Addgene (#17448) and the plasmids containing Tat1b and Rev1b (SARS-Related Coronavirus 2 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Bot oligo – 5’-aaacTTGGCACTCCATTAGATCCG-3’) were cloned into U6.3>gRNA.f+e (#99139, Addgene) and electroporated at a concentration of 1.5 ug/ul ...
-
bioRxiv - Neuroscience 2020Quote: ... The entire coding sequence of GCaMP6s was amplified by PCR with primers 5’–GGATCCGCCACCATGGGTTCTCATCATCATCA–3’ and 5’–GTAGCCGAACCGGTCTTCGCTGTCATCATTTGTAC–3’ using pGP-CMV-GCaMP6s (Addgene plasmid # 40753; http://n2t.net/addgene:40753; RRID:Addgene_40753) as a template ...
-
bioRxiv - Molecular Biology 2024Quote: ... Two guide RNA sequences were selected to target exon 1 of mtIF3 as described previously (5′-GCAAUAGGGGACAACUGUGC-3′ and 5′-GCAGAGUAUCAGCUCAUGAC-3′) 59 and cloned into the pL-CRISPR.EFS.GFP (a gift from Benjamin Ebert, Addgene plasmid # 57818 ...
-
bioRxiv - Neuroscience 2023Quote: ... slices were virally infected with 0.5-1 µl AAV mixture per slice (containing AAV9-Camk2a-Cre at 2 × 1012 vg/ml (1:1000 dilution, Addgene and rAAV8-DIO-CBA-pAAIP2-mEGP at 4.2 x 1012 vg/ml ...
-
bioRxiv - Developmental Biology 2020Quote: ... targeting the 5’ (5’-AGTGCGCTTCGTCACTGCAC-3’) and 3’ (5’-TCCTCCCGCCCCGACGCGGA-3’) region of the Spen ORF were cloned in the Cas9-GFP pX458 vector (Addgene plasmid #48138). Compatible 5’ and 3’ Homology arms (HA ...
-
bioRxiv - Cancer Biology 2021Quote: MEFs were seeded in 6-well plates and transfected for 6-8 h with 1 μg of plasmid 4XCLEAR-luciferase reporter (Addgene, 66800) and 0.1 ug of CMV-Renilla Luciferase (Promega ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 μg pCAS9-mCherry-Frame+1 (Addgene #66940), and 5 μg of pCRISPR-HOT_mNEON plasmid (a kind gift from Hans Clevers ...
-
bioRxiv - Cell Biology 2021Quote: ... a single guide RNA targeting Pml exon 1 (Table 4) was subcloned into the pSpCas9 (BB)-2A-Puro plasmid (pX459v2, Addgene) and transfection of mESCs was performed using lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: 10-cm dishes containing 50-80% confluent 293T cells in 10% FBS/DMEM were co-transfected with 4 µg of spike pcDNA3.1(+) or 1 µg spike VRC8400 plasmids and 0.5 µg of eGFP plasmid (Addgene plasmid # 160697) [61] (Effector cells ...
-
bioRxiv - Neuroscience 2024Quote: Rats were anesthetized with isoflurane (induction: 4%; maintenance: 1–2.5%) and received either AAV8-hSyn-hM4Di-mCherry (Addgene #50475-AAV8) or AAV8-hSyn-mCherry (Addgene #114472-AAV8) ...
-
bioRxiv - Neuroscience 2021Quote: ... and pCXLE-hOCT3/4-shp53-F (Addgene plasmid #27077; http://n2t.net/addgene:27077;RRID:Addgene_27077) [pCXLE-hUL ...
-
bioRxiv - Genetics 2021Quote: We digested the human STARR-seq screening vector (hSTARR-seq_SCP1 vector_blocking 4, Addgene #99319) with both Thermo SgrDI and BshTI (AgeI ...
-
bioRxiv - Cell Biology 2020Quote: HA-NFAT1(4-460)-GFP was a gift from Anjana Rao (Addgene plasmid # 11107). Patterned cells expressing NFAT-GFP was imaged using Zeiss LSM 880 ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV1-phSyn1(S)-FLEX-TdTomato-T2A-Syp-EGFP (Addgene #51509, 4 x 1014GC/mL) was injected (60nL at 20nL/min ...
-
bioRxiv - Cell Biology 2024Quote: ... were constructed by inserting annealed synthetic oligomers (5′-CACCgcagctcctgcctctcatcg-3′ and 5′-AAACcgatgagaggcaggagctgc-3′) into the Bbs I site of pX330-U6-Chimeric_BB-CBh-hSpCas9 vector (#42230; Addgene, Watertown ...
-
bioRxiv - Cancer Biology 2020Quote: WM266-4 or SK-MEL-2 cells were co-transduced with conditioned media containing lentiviruses bearing Firefly luciferase-7TFP (Addgene #24308, β-catenin reporter) and Renilla luciferase pLenti.PGK.blast-Renilla Luciferase (Addgene #74444 ...