Labshake search
Citations for Addgene :
201 - 250 of 1373 citations for 5 2 Chloronicotinoyl 2 furoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... pEGFP-ZO-2 was a gift from Marius Sudol (Addgene plasmid # 27422 ...
-
bioRxiv - Developmental Biology 2023Quote: ... pBS-KS-attB2-SA(2)-T2A-GAL4DBD-Hsp70 (Addgene #62904), pBS-KS-attB2-SA(0)-T2A-VP16AD-Hsp70 (Addgene #62905) ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 mg Gag-Pol expression vector psPAX2 (Addgene #12260) using Jet Pei reagent (Polyplus ...
-
Cellular sialoglycans are differentially required for endosomal and cell-surface entry of SARS-CoV-2bioRxiv - Microbiology 2024Quote: ... plasmids pTwist-SARS-CoV-2 d18 B.1.617.2v1 (Addgene #179905) and pTwist-SARS-CoV-2 d18 B.1.1.529 (Addgene #179907 ...
-
Cellular sialoglycans are differentially required for endosomal and cell-surface entry of SARS-CoV-2bioRxiv - Microbiology 2024Quote: ... and pTwist-SARS-CoV-2 d18 B.1.1.529 (Addgene #179907) were kindly shared by Dr ...
-
bioRxiv - Neuroscience 2024Quote: ... and AAV-flex-GCaMP6f (Addgene #100833, 2 × 1013 gc/mL) was injected into the PL ...
-
bioRxiv - Bioengineering 2024Quote: ... derived from Prime editor 2 system (PE2, Addgene plasmid #132775) 15 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and WPMY cells were overexpressed with Wnt-2 (Addgene 43809). All flag plasmids were manufactured by Gene Universal ...
-
bioRxiv - Cell Biology 2022Quote: ... GGAACAAGTTCAGTGAACTG, #3: TGCATGCTCACTGATAATGA), IFIH1 (#1: CTTGGACATAACAGCAACAT, #2: TGAGTTCCAAAATCTGACAT) or TLR3 (#1: ACGACTGATGCTCCGAAGGG, #2: ACTTACCTTCTGCTTGACAA, #3: GGAAATAAATGGGACCACCA) and control gRNAs (Addgene plasmid #51763, #51762 and #51760) were ligated into pLentiCRISPRv2 (Addgene plasmid # 52961 ...
-
bioRxiv - Bioengineering 2020Quote: ... and pcDNA3-SARS-CoV-2-S-RBD-Fc (Addgene Plasmid #141183) were obtained as gifts from Erik Procko ...
-
bioRxiv - Molecular Biology 2021Quote: ... (2) LwaCas13a coding sequence and Shine-Dalgarno sequence amplified from Addgene #91865 using primers oAM1496 and oAM1497 ...
-
bioRxiv - Molecular Biology 2021Quote: SARS-CoV-2 viral proteins were amplified via PCR from Addgene constructs with a 1x (GGGS ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 spike or VSV-G (pMD2.G (Addgene #12259)) using VigoFect (Vigorous Biotechnology) ...
-
bioRxiv - Biochemistry 2021Quote: ... and SARS-CoV-2 nsp14/nsp10-His-3xFlag (Addgene ID 169164) were expressed in baculovirus-infected Sf9 insect cells ...
-
bioRxiv - Biochemistry 2021Quote: ... we co-transformed plasmids SARS-CoV-2 nsp10 (Addgene ID 169158) and SARS-CoV-2 3xFlag-nsp5CS-nsp14 (Addgene ID 169159) ...
-
bioRxiv - Biophysics 2021Quote: ... the pet28 plasmid containing His6 SARS-CoV-2 nsp13 (Addgene #159390) was transformed into E ...
-
bioRxiv - Neuroscience 2020Quote: Brainbow3.0 AAV-2/9 and AAV-PhP.EB were obtained from Addgene and University of Michigan vector core ...
-
bioRxiv - Systems Biology 2021Quote: ... and pX458-sgRNA_miR290-295_1/2 for KO2 (Addgene #172709 and #172710). After 48 hours ...
-
bioRxiv - Microbiology 2021Quote: ... Expression vectors for SARS-CoV-2 Wuhan-Hu-1 (Addgene, #149539), SARS-CoV-2 B.1.167.2 (Addgene ...
-
bioRxiv - Physiology 2021Quote: EGFP-hArgonaute-2 (eGFP-Ago2) was purchased from (Addgene plasmid # 21981) and was prepared in the laboratory of Philip Sharp (MIT) ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV1-flex-ChR2-Tdtomato (Addgene, titer 2*1012/ml, 0.5 μl) or AAV1-flex-ChR2-mCherry (Charite Vector core ...
-
bioRxiv - Cell Biology 2021Quote: The human GeCKO v2 library (2 plasmid system) (Addgene plasmid #1000000049) was amplified by electroporation using a Bio-Rad Gene Pulser II electroporation apparatus (Bio-Rad #165-2105 ...
-
bioRxiv - Cell Biology 2020Quote: Plasmids for biosensors were purchased from Addgene (see Supplementary Table 2). ERKKTR ...
-
bioRxiv - Cell Biology 2021Quote: ... and the three injection markers pCFJ90 (Pmyo-2::mCherry, Addgene #19327), pCFJ104 (Pmyo-3::mCherry ...
-
bioRxiv - Neuroscience 2022Quote: pAAV2/2-hSyn-DIO-hM4D(Gi)-mCherry (Addgene #44362, Roth Lab) was injected intraocularly in VGluT3-Cre mice ...
-
bioRxiv - Molecular Biology 2022Quote: ... psPAX2 packaging vector (2 µg, a gift from Didier Trono; Addgene plasmid #12260 ...
-
bioRxiv - Microbiology 2022Quote: ... 2 µg pSPAX2 (a kind gift from Didier Trono; Addgene #12260), and 2 µg of pcDNA3- SΔ19 with PEI ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 μg pMD2.G envelope plasmid (plasmid #12259; Addgene, Teddington, UK), and 12 μg of the pLJM1 vector for overexpression (plasmid #19319 ...
-
bioRxiv - Genetics 2020Quote: ... Lentiviral particles were generated in 293T cells using pMDG.2 (Addgene) and psPAX2 (Addgene ...
-
bioRxiv - Cancer Biology 2021Quote: ... gRNA-1 and -2 were cloned into pL-CRISPR.EFS.GFP (Addgene, #57818) and pL-CRISPR.EFS.tRFP (Addgene plasmid #57819) ...
-
bioRxiv - Microbiology 2023Quote: ... and cloned into UC Berkeley Macrolab vector 2-CT (Addgene #29706), which encodes an N-terminal TEV protease cleavable His6-MBP (maltose binding protein ...
-
bioRxiv - Neuroscience 2023Quote: ... virus for optogenetic inhibition or excitation of preBötCOT-R neurons in OT-R::Cre mice was obtained from Addgene (Table 2, Addgene viral prep # 154951; http://n2t.net/addgene:154951; RRID:Addgene_154951)32 ...
-
bioRxiv - Neuroscience 2024Quote: ... driven by synapsin promoter (Addgene, 100843-AAV9, 2×109 vg/coverslip) (20) ...
-
bioRxiv - Neuroscience 2023Quote: ... The AAV1-phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE virus for tracing experiments from preBötCOT-R neurons to nACardiac neurons in OT-R::Cre mice was obtained from Addgene (Table 2, Addgene viral prep # 51509; http://n2t.net/addgene:51509; RRID:Addgene_51509)55.
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μg of plasmid expressing CRISPR-Cas9 and guide (Addgene #42230) and 40 pmol ssDNA repair template were transfected using Lipofectamine 3000 (Invitrogen L3000001 ...
-
bioRxiv - Microbiology 2024Quote: ... pcDNA3.1-Ha-Dynamin 2.K44A (gift of S. Schmid, Addgene 34685), pEGFPC1 (Clontech) ...
-
bioRxiv - Microbiology 2024Quote: ... pEGFP-Dynamin 2.K44A (gift of P. De Camilli; Addgene 22301), and pEGFP-Dynamin 2ΔPRD (50 ...
-
bioRxiv - Developmental Biology 2022Quote: The Capture sequence 2 was added to the gRNA_Purp_Backbone (Addgene #73797) by PCR ...
-
bioRxiv - Neuroscience 2022Quote: [2] piggyBac backbone from pBAC-ECFP-15xQUAS_TATA-SV40 (Addgene, ID #104875) (Riabinina et al. ...
-
Zero-shot learning enables instant denoising and super-resolution in optical fluorescence microscopybioRxiv - Bioengineering 2023Quote: ... and the sgRNA was ligated into pX330A-1×2 (Addgene, 58766). To construct donor vector ...
-
bioRxiv - Genomics 2022Quote: ... and pSLQ1852-2 pHR: U6-SpsgCD95-1 CMV-EGFP (Addgene 84151) with slight modifications ...
-
bioRxiv - Developmental Biology 2023Quote: ... and pBS-KS-attB2-SA(2)-T2A-p65AD-Hsp70 (Addgene #62915). The integration orientation of yellow progenies from MiMIC injection and 3xP3-GFP-progenies from CRIMIC injection were confirmed by PCR genotyping ...
-
bioRxiv - Systems Biology 2023Quote: ... Each promoter was then cloned into the pMW#2 (Addgene #13349) and pMW#3 (Addgene #13350 ...
-
bioRxiv - Microbiology 2023Quote: ... 2 mg VSV-G Env expression vector pMD2.G (Addgene #12259) and 2 mg Gag-Pol expression vector psPAX2 (Addgene #12260 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and pDONR207 SARS-CoV-2 nsp1 R124A/K125A (M2, Addgene #164523) plasmids using the primers 5-EX-NSP1 and 3-NB-NSP1 and cloned into pEGFP-N1 digested with EcoRI and NotI enzymes ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1000 ng frame selector (pCAS9-mCherry-Frame +0/+1/+2, Addgene plasmid #66939/#66940/#66941 ...
-
bioRxiv - Cell Biology 2024Quote: ... and marker pCFJ90 (Pmyo-2-mCherry; Addgene #19327, 2.5 ng/µL) was injected into N2 young adult hermaphrodites ...
-
bioRxiv - Neuroscience 2024Quote: ... Each sgRNA was cloned into pU6-2-sgRNA-short (Addgene 41700) plasmid and two plasmids were co-injected into vas-Cas9 line (BDSC # 51324 ...
-
bioRxiv - Molecular Biology 2024Quote: ... pLVX-M-2×Strep-IRES-Puro(Addgene#141386, Wuhan-Hu-1) with NotI/BamHI- ...
-
bioRxiv - Molecular Biology 2024Quote: ... pLVX-E-2×Strep-IRES-Puro (Addgene#141385, Wuhan-Hu-1), pLVX-M-2×Strep-IRES-Puro(Addgene#141386 ...