Labshake search
Citations for Addgene :
2401 - 2450 of 4199 citations for 6H Dibenzo a g quinolizinium 5 8 13 13a tetrahydro 2 9 dihydroxy 3 10 dimethoxy 7 methyl 7S 13aS since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2019Quote: ... pMD2.G was a gift from Didier Trono (Addgene plasmid # 12259; http://n2t.net/addgene:12259; RRID:Addgene_12259).
-
bioRxiv - Biochemistry 2021Quote: ... or pHAGE plasmids for overexpression were co-transfected with packaging vectors (psPAX2 and pMD2.G, Addgene) into 293T cells using lipofectamine 2000 (Invitrogen) ...
-
AGS3 antagonizes LGN to balance oriented cell divisions and cell fate choices in mammalian epidermisbioRxiv - Developmental Biology 2022Quote: ... Packaging of lentivirus was performed using 293FT cells and pMD2.G and psPAX2 helper plasmids (Addgene plasmids #12259 and #12260 ...
-
bioRxiv - Genetics 2022Quote: ... pMD2.G was a gift from Didier Trono (Addgene plasmid #12259; http://n2t.net/addgene:12259; RRID:Addgene_12259). psPAX2 was a gift from Didier Trono (Addgene plasmid #12260 ...
-
bioRxiv - Molecular Biology 2019Quote: ... pMD2.G was a gift from Didier Trono (Addgene plasmid # 12259; http://n2t.net/addgene:12259; RRID:Addgene_12259).
-
bioRxiv - Immunology 2020Quote: ... and lentiviral particles were generated in 293T cells (ATCC) using packaging plasmids pMD2.G (Addgene #12259) and psPAX2 (Addgene #12260 ...
-
bioRxiv - Microbiology 2020Quote: ... The VSV-G encoding plasmid and lentiviral packaging plasmid psPAX2 were obtained from Addgene (Cambridge, MA). The pLenti-GFP lentiviral reporter plasmid that expresses GFP and luciferase was generously gifted by Fang Li ...
-
bioRxiv - Neuroscience 2020Quote: ... and pMD2.G (a gift from Didier Trono (Addgene plasmid # 12259; http://n2t.net/addgene:12259; RRID:Addgene_12259)) ...
-
bioRxiv - Biochemistry 2020Quote: ... cell transfection method as described previously (Purroy et al., 2018) using the plasmids pMD2.G (RRID:Addgene_12259) and psPAX2 (RRID:Addgene_12260 ...
-
bioRxiv - Cancer Biology 2021Quote: ... or pSRE-Luciferase plasmid from ATCC (# MBA-120) together with packaging plasmids pMD2.G (Addgene, #12259), psPAX ...
-
bioRxiv - Genomics 2020Quote: ... and the lentiviral envelope vector pMD2.G (kind gift from the Didier Trono lab, Addgene #12259) were co-transfected with the respective lentiviral expression vector (∼1:1:3 molar ratio ...
-
bioRxiv - Immunology 2021Quote: ... and pCMV-VSV-G (a gift from Dr. Weinberg through Addgene; http://n2t.net/addgene:8454; RRID:Addgene_8454), following Lipofectamine 3000 transfection instructions for a 10 cm dish (Invitrogen ...
-
bioRxiv - Genomics 2021Quote: ... CRISPR plasmids were co-transfected in 60 % confluent HEK293T with packaging vectors pMD2.G (Addgene #12259), psPAX2 (Addgene #12260 ...
-
bioRxiv - Developmental Biology 2022Quote: Lentivirus was generated in HEK293T cells using a second-generation system with pMD2.G (Addgene 12259) and psPAX2 (Addgene 12260) ...
-
bioRxiv - Genomics 2022Quote: ... HEK293T were transfected with the respective lentiviral vectors and packaging plasmids pMD2.G (Addgene no. 12259) as well as psPAX2 (Addgene no ...
-
bioRxiv - Microbiology 2022Quote: ... pMD2.G was a gift from Didier Trono (Addgene plasmid # 12259; http://n2t.net/addgene:12259; RRID:Addgene_12259). pBlades plasmids coding for single-guide RNAs targeting the genes coding for eL8 (RPL7a) ...
-
bioRxiv - Molecular Biology 2023Quote: ... pMD2.G was a gift from Didier Trono (Addgene plasmid # 12259; http://n2t.net/addgene:12259; RRID:Addgene_12259). psPAX2 was a gift from Didier Trono (Addgene plasmid # 12260 ...
-
bioRxiv - Cancer Biology 2024Quote: ... pMD2.G was a gift from Didier Trono (Addgene plasmid # 12259; http://n2t.net/addgene:12259; RRID:Addgene_12259).
-
bioRxiv - Biophysics 2024Quote: ... Lentiviral vectors were co-transfected with the lentiviral packaging plasmids pCMV-VSV-G (Addgene plasmid #8454) and pCMV-dR8.2 (Addgene plasmid #8455 ...
-
bioRxiv - Biochemistry 2024Quote: ... NM_018344.6 (SLC29A3):c.1427A>G (p.Ter476Trp) and NM_000343.4(SLC5A1):c.1993T>C (p.Ter665Arg)) were cloned into pCDNA3.1-HA (Addgene 128034) using Gibson assembly ...
-
bioRxiv - Biochemistry 2024Quote: ... The pSPAX2 and pMD2.G plasmids for lentiviral packaging were acquired from Addgene (#12260 and #12259).
-
bioRxiv - Cell Biology 2024Quote: ... pMD2.G was a gift from Didier Trono (Addgene plasmid # 12259; http://n2t.net/addgene:12259; RRID:Addgene_12259). psPAX2 was a gift from Didier Trono (Addgene plasmid # 12260 ...
-
bioRxiv - Molecular Biology 2023Quote: ... the transfection mixture was prepared by combining lentiviral packaging plasmids 7.5 μg pMD2.G (#12259, Addgene), 11.4 μg pMDLg-RRE (#12251 ...
-
bioRxiv - Cancer Biology 2023Quote: ... HEK293T cells were transfected with viral packaging plasmids psPAX2 Addgene #12260) and pMD2.G (Addgene#12259), and pLKO.1 shRNA using Lipofectamine 3000 (Invitrogen) ...
-
bioRxiv - Genomics 2022Quote: ... HEK-293T cells were transfected with shRNA constructs and lentiviral packaging constructs pMD2.G (Addgene #12259) and psPAX2 (Addgene #12260) ...
-
bioRxiv - Neuroscience 2023Quote: Lentiviral vectors were made as described87 but with the VSVG expression vector pMD2.G (Addgene 12259) as the envelope plasmid and with the following transfer vectors:
-
bioRxiv - Cell Biology 2023Quote: ... pMD2.G was a gift from Didier Trono (Addgene plasmid # 12259; http://n2t.net/addgene:12259; RRID:Addgene_12259)
-
bioRxiv - Genetics 2023Quote: ... pCMV-VSV-G (a gift from Bob Weinberg (Addgene plasmid #8454; http://n2t.net/addgene:8454; RRID:Addgene_8454))(103)and the Lenti guide puro-GFP gRNA plasmid ...
-
bioRxiv - Genomics 2023Quote: ... HEK293T cells were co-transfected with two packaging plasmids (pCMV-VSV-G and delta8.9, Addgene #8454) and either a desired transfer plasmid ...
-
bioRxiv - Immunology 2023Quote: ... The gRNA construct was then co-transfected with two packaging plasmids (pMD2.G and pSPAX2, Addgene) into HEK293T cells to produce lentiviruses ...
-
bioRxiv - Molecular Biology 2023Quote: ... pMD-G was a gift from Simon Davis (Addgene plasmid # 187440; http://n2t.net/addgene:187440; RRID:Addgene_187440) (83) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Tet-pLKO-puro vectors were packaged into a lentivirus system with pCMV-VSV-G (Addgene, #8454) and psPAX2 (Addgene ...
-
bioRxiv - Microbiology 2023Quote: ... constructed with pCMV-VSV-G)(110), p5349 (pBS-CMV-gagpol, a gift from Patrick Salmon (Addgene plasmid # 35614 ...
-
bioRxiv - Developmental Biology 2023Quote: ... the lentiviral packaging plasmids 800 ng pMD2.G (was a gift from Didier Trono, Addgene #12259) and 2400 ng psPAX2 (was a gift from Didier Trono ...
-
bioRxiv - Cell Biology 2023Quote: pPGK-Cre lentiviral backbone was amplified and transfected into 293T cells using VSV-G (Addgene 8454) and psPAX2 (Addgene 12260 ...
-
bioRxiv - Molecular Biology 2024Quote: pMD2.G was a gift from Didier Trono (Addgene plasmid # 12259 ; http://n2t.net/addgene:12259 ; RRID:Addgene_12259)
-
bioRxiv - Cancer Biology 2024Quote: HEK293T cells were transfected with a shuttle vector plasmid and packaging plasmids pMD2.G (Addgene, #12259) and psPAX (Addgene ...
-
bioRxiv - Microbiology 2024Quote: ... 293T cells were transfected with psPAX2 and pMD2.G (gifts from Didier Trono – Addgene #12260, #12259) and pTRIPZ lentiviral vectors ...
-
bioRxiv - Microbiology 2024Quote: ... pCMV-VSV-G (a gift from Bob Weinberg, Addgene plasmid #8454, http://n2t.net/addgene:8454, RRID:Addgene_8454), and psPAX2 (a gift from Didier Trono ...
-
bioRxiv - Biophysics 2022Quote: Human kinesin-5 (Kif11/Eg5) 5-513 was PCR amplified from mCherry-Kinesin11-N-18 plasmid (gift from Michael Davidson, Addgene # 55067). This fragment was previously shown to form functional dimers [19] ...
-
bioRxiv - Biochemistry 2021Quote: ... guide sequences 5’GGCATTGCCCGTCATGGCCC3’ and 5’GTCTTCACCGAGCTCATTAA3’ were cloned into pX330-U6-Chimeric_BB-CBh-hSpCas9 (a gift from Feng Zhang; Addgene plasmid # 42230) and co-transfected with a GFP-expressing plasmid into HCT116 cells using Lipofectamine 2000 ...
-
bioRxiv - Developmental Biology 2024Quote: ... gcgtgtgttcccagatgtat) and PCR donor generated with primers AP677/678 (5’Biotin::taagtgccaaggctgccaggcgtgtgttcccagaaacaccccaggaatcaacc and 5’Biotin::gtttttactcacccgatcgcctttctcaccaatacacttgtcatcgtcatccttg) on plasmid AP635 (Addgene #99485). Genotyping shows scarless insertion in the coding sequence ...
-
bioRxiv - Bioengineering 2019Quote: ... Neurons were dissociated and seeded on 4 different MEAs at ~3000 cells/mm2 over the electrode area and cultured in NbActiv1™ medium for at least 7-14 days prior to transfection with Fubi-ChR2-GFP (Addgene plasmid # 22051) or 21 days prior to transfection with C1V1tt (Addgene plasmid # 35497) ...
-
bioRxiv - Neuroscience 2024Quote: ... and a bilateral infusion of either AAV2.CMV::nNOS-shRNA-EGFP or AAV2.CMV::luciferase-shRNA-EGFP combined with an AAV2.hsyn::DIO-mCherry (Addgene, titer: ∼7×1012) into the NAcore ...
-
bioRxiv - Neuroscience 2024Quote: ... All rats received bilateral microinjections of AAV2.CMV::nNOS-shRNA-EGFP or AAV2.CMV::luciferase-shRNA-EGFP (USC viral vector core: titer∼∼7×1013 vg/mL) combined with an AAV2.CAG::Flex-Ruby2sm-Flag.WPRE.SV40 (Addgene: titer: ∼1×1012 vg/ml) into the NAc ...
-
bioRxiv - Neuroscience 2023Quote: ... 1:2 dilution) or AAV5-pCAG-FLEX-EGFP-WPRE (1.1 x 1013 gc/ml, Addgene; 1:2 dilution) was injected in VTA (from bregma ...
-
bioRxiv - Developmental Biology 2021Quote: ... or exon 3 of TET3 and cloned into pX330 vector (Addgene #42230) as previously described 47 ...
-
bioRxiv - Developmental Biology 2019Quote: ... 3 µg of the pX-EGFP-g1 expression plasmid (Addgene plasmid #107273)28 was transfected into 1.0 × 106 gene-targeted patient iPSCs ...
-
bioRxiv - Neuroscience 2021Quote: pAAV-CaMKIIa-eGFP (titer ≥ 3×1012 vg/mL, Addgene, catalog # 50469-AAV5) and pAAV5-CaMKII-hChR2(H134R)-eYFP-WPRE (titer ≥ 1×1013 vg/mL ...
-
bioRxiv - Neuroscience 2019Quote: ... which were inserted into pDD162 (Peft-3::Cas9 + Empty sgRNA; Addgene #47549), respectively ...