Labshake search
Citations for Addgene :
2401 - 2450 of 2656 citations for 4' Trifluoromethoxy 5 trifluoromethyl 1 1' biphenyl 3 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... These GFP positive cells were transduced with lentiviral particles for pLenti CMV rtTA3 Hygro (w785-1) (a gift from Eric Campeau Addgene plasmid number 26730) for tetracycline inducible expression and selected using hygromycin (200μg/ml) ...
-
bioRxiv - Cell Biology 2022Quote: ... and pLKO.6 sfCherry were generated from pLKO.1 puro plasmid (Addgene plasmid # 8453; http://n2t.net/addgene:8453; RRID:Addgene_8453; a gift from Bob Weinberg) (Stewart et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... SKO cells were transfected with pSH-EFIRES-P-GFP(1-10)opti AAVS1 Safe Harbor integration plasmid (Addgene plasmid # 129416, [35] and pCas9-sgAAVS1-2 (Addgene plasmid # 129727 [47]), and a stable pool was selected using puromycin (1 µg/ml puromycin for 6 days ...
-
bioRxiv - Neuroscience 2021Quote: stGtACR2: 300 nL 1:10 AAV2/8-hSyn1-SIO-stGtACR2-FusionRed (working concentration 4.7*1011 gc/mL, Addgene/Janelia Viral Core, Ashburn, VA)
-
bioRxiv - Neuroscience 2020Quote: Stereotaxic injection of AAV-EF1a-DIO-HChR2(H134R)-eYFP (serotype 2/1 or 2/9, U. Penn Vector Core, Philadelphia, PA, USA or Addgene, Watertown, MA, USA) was performed in 6-8 weeks old DAT-IRES-Cre or FoxP2-Cre transgenic mice ...
-
bioRxiv - Neuroscience 2020Quote: ... a pair of complementary 20 bp oligos for each guide RNA sequence was annealed and cloned into pX330 (Addgene 42230; for guide 1) or pSG (a shuttle vector ...
-
bioRxiv - Cell Biology 2022Quote: Dynamin-1-mCherry and dynamin-1(K44A)-mCherry were made by replacing the GFP from WT Dyn1 pEGFP and K44A Dyn1 pEGFP (Addgene #34680 and #34681), respectively ...
-
bioRxiv - Microbiology 2020Quote: ... was obtained through Addgene as a ready-to-use lentiviral pooled library at a titer ≥ 1×107 TU/mL (Addgene, cat. #73178-LV). To deliver the Brunello sgRNA library ...
-
bioRxiv - Developmental Biology 2021Quote: ... with the only exception of ΔR2 and ΔF_ALL_Inv that were generated by using a pair of sgRNA. The guide sequences (listed in Supp. Table 1) were then cloned in px459 CRISPR/Cas9 vector (Addgene Cat. N. 62988), previously digested with Bbs1 ...
-
bioRxiv - Immunology 2020Quote: A short-guide RNA targeting the BFL-1 transcriptional start site was cloned into the BsmbI-digested dCas9-KRAB-GFP (Addgene #71237, RRID: Addgene_71237) or lentiguide-puromycin (Addgene #52963 ...
-
bioRxiv - Biophysics 2023Quote: The full-length α-synuclein monomer (1−140) expression plasmid (pET21a-alpha-synuclein) was a gift from Michael J Fox Foundation MJFF (Addgene plasmid # 51486). The α-synuclein monomer was expressed and purified following the previous method20,21 ...
-
bioRxiv - Neuroscience 2022Quote: ... Dual opsin-assisted circuit mapping and opto-tagging in brain slices: AAV2/-Syn-ChrimsonR-tdT (Addgene plasmid 59171, 1.3×1013 GC ml-1); AAV2/1-CAG-Flex-FlpO (made in house ...
-
bioRxiv - Neuroscience 2023Quote: ... Tetanus Neurotoxin Light Chain (TeLC) viruses were generated using AAV5-hSyn-FLEX-TeLC-P2A-dTomato (Addgene, 159102, 1 × 1013 genome copies per ml) at ISTA viral facility ...
-
bioRxiv - Neuroscience 2024Quote: ... Wild-type animals were then injected whether with mix 1 or mix 2 or AAV9-CamKII-GCaMP6f-WPRE-SV40 (Addgene, 100834, vg/mL) or AAV9-CamKII-hM4D(Gi)-mCherry (construct provided by Bryan Roth ...
-
bioRxiv - Molecular Biology 2024Quote: ... The synthetic sgRNA oligo pair complementary to exon 1 was designed and cloned into lentiCRISPRv2 vector (Addgene #52961, gift from Dr. Feng Zhang)143 following the published protocol.49 For virus production ...
-
bioRxiv - Neuroscience 2024Quote: ... All rats received bilateral microinjections of AAV2.CMV::nNOS-shRNA-EGFP or AAV2.CMV::luciferase-shRNA-EGFP (USC viral vector core: titer∼∼7×1013 vg/mL) combined with an AAV2.CAG::Flex-Ruby2sm-Flag.WPRE.SV40 (Addgene: titer: ∼1×1012 vg/ml) into the NAc ...
-
bioRxiv - Cell Biology 2023Quote: ... and EBP50-PDZ12 (aa 1-298) cloned into the pCMV-2-FLAG vector were gifts from Maria-Magdalena Georgescu (Addgene plasmids #28291-28297).
-
bioRxiv - Genetics 2024Quote: We use two constructs for epigenome editing: 1) dCAS9-DNMT3A/3L co-expressed with enhanced green fluorescent protein (eGFP) for selection 12 (Addgene, Catalogue number 128424), and 2 ...
-
bioRxiv - Neuroscience 2024Quote: ... sechellia nos-Cas9 (Auer et al., 2020) or co-injected with pHsp70-Cas9 (400 ng μl−1) (Addgene #45945; for D. simulans transgenesis) (Gratz et al. ...
-
bioRxiv - Cancer Biology 2024Quote: Human DSRCT cell lines JN-DSRCT-1 and SK-DSRCT2 were transduced with lentiviruses encoding the TET-pLKO-puro vector (Plasmid #21915, Addgene, Watertown, MA, USA) containing a puromycin resistance and doxycycline (DOX)-inducible expression cassette of short hairpin RNAs (shRNAs ...
-
bioRxiv - Neuroscience 2024Quote: ... the Cap gene of AAVhu.32 (GeneBank: AY530597.1) was synthesized (Sangon Biotech Co., Ltd., Shanghai, China) and ligated into the pAAV-RC2/1 vector (Addgene, Watertown, MA, USA, 112862). In the principle of point mutation ...
-
bioRxiv - Systems Biology 2022Quote: ... we first prepare the vector backbone by incubating 5 ug of PB-TRE-dCas9-VPR (Addgene #63800) for 2 h at 37°C with 2 ul of FastDigest FspAI (ThermoFisher cat ...
-
bioRxiv - Cell Biology 2022Quote: ... Viral transductions were done on day 6 with 5 μL of AAV1-CaMKII-GLuc-ASARTDL (Addgene 149503) or AAV1-CaMKII-GLuc-Untagged (Addgene 149502 ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells were transduced with floxed jGCaMP7b (AAV1-syn-FLEX-jGCaMP7b-WPRE; Addgene #104493, MOI = 5×105 vg) [14] and low-titer Cre (AAV9-hSyn-Cre-WPRE-hGH ...
-
bioRxiv - Systems Biology 2022Quote: ... we prepared the vector backbone by incubating 5 ug of UCOE-SFFV-dCas9-BFP-KRAB (Addgene #85969) for 2 h at 37 °C with 2 ul of FastDigest BamHI (ThermoFisher cat ...
-
bioRxiv - Neuroscience 2022Quote: ... Circuit-specific viral expression was achieved using the retrograde properties of adeno-associated virus (AAV) serotype 5 23: AAV5.hSyn.HI.eGFP-Cre.WPRE.SV40 (Addgene; #105540). Sparse labelling was obtained using Cre-inducible ...
-
bioRxiv - Cell Biology 2020Quote: ... Animals received a single dose of AAV8.TBG.null or AAV8.TBG.p21 (5*10^12 units/ml) (Addgene) intravenously allowed 1 week wash-out period on normal diet ...
-
bioRxiv - Neuroscience 2023Quote: ... anesthetized RiboTag RT +/+ mice were bilaterally injected with AAV5-Cre viruses (AAV sterotype 5 AAV5.hSyn.HI.eGFP-Cre.WPRE.SV40 (Addgene; #105540) at the following coordinates ...
-
bioRxiv - Neuroscience 2023Quote: ... 400 nl of AAV2/5-CAG-dLight1.1 (1.7×1013 GC/ml, 111067-AAV5, Addgene, Watertown, MA, USA) was slowly injected into the DMS (n = 7 ...
-
bioRxiv - Genetics 2023Quote: ... the FKBP coding sequence was amplified from the PM-FRB-Cerulean-T2A-FKBP-5-ptase plasmid (Addgene 40897 ...
-
bioRxiv - Cell Biology 2023Quote: ... pLenti CMV GFP Puro (658-5) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid #17448). mito-BFP was a gift from Gia Voeltz (Addgene # 49151) ...
-
bioRxiv - Cell Biology 2023Quote: A 5’ 3xHA-Tag sequence were inserted into pMSCV-IRES-GFP II (MIG) plasmid (Addgene, Plasmid #52107;23). Human GATA2 WT ...
-
bioRxiv - Systems Biology 2024Quote: We established a stable Cas9-expressing line by infecting EpiSC-5 cells with lentiCas9- Blast (Addgene 52962), followed by selection with 5 µg/ml blasticidin (Sigma 15205 ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV2/5.CaMKII.tdTomato (Neurophotonics, 661-aav5) was used to label excitatory neurons and AAV9.CaMKII.GCaMP6s.WPRE.SV40 (Addgene, 107790) was employed to image excitatory neuronal calcium activity ...
-
bioRxiv - Neuroscience 2023Quote: ... RRID:Addgene_20297) or eYFP alone as a control (AAV-EF1a-DIO-eYFP; serotype 5; Dr. Karl Deisseroth; RRID:Addgene_27056).
-
bioRxiv - Neuroscience 2022Quote: ... mRuby-ER-5 was a gift from Michael Davidson (Addgene plasmid #55860; http://n2t.net/addgene:55860; RRID:Addgene_55860). Matrix-roGFP (mt-roGFP ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and the first 639 bp of the 5’ end of p65HSF1 from pAC1393-pmax-NLSPUFa_p65HSF1 (Addgene, #71897). These were then Gibson assembled along with an IDT gBlock containing the last 300 bp of p65HSF1 that had been codon optimised for expression level detection distinct from endogenous mRNA ...
-
bioRxiv - Cell Biology 2023Quote: ... and the sgRNA cassettes were assembled into pGGG-M along with end linker pELE-5 (Addgene #48020). The resulting plasmids were named pGGG-ZIP4-B2 Construct 1 (containing sgRNA 4 and 12 ...
-
bioRxiv - Cancer Biology 2024Quote: ... The pLenti-ATF4-uORF-GFP reporter plasmid was generated by placing the ATF4 5’UTR from Addgene plasmid #21850 ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 million HeLa cells were resuspended in 400 μL DMEM with 2 μg SpCas9 plasmid (Addgene, 71814), 500 ng gRNA plasmid ...
-
bioRxiv - Molecular Biology 2024Quote: ... sgRNAs targeting PCNA exon 5 (PCNAex5_gRNA_1: ATACGTGCAAATTCACCAGA; PCNAex5_gRNA_2: GCAAGTGGAGAACTTGGAAA) were cloned into hSpCas9(BB)-2A-GFP (PX458, Addgene 48138). Double-stranded donor plasmids containing the K164R coding mutation (c.491 A>G ...
-
bioRxiv - Neuroscience 2024Quote: ... a volume of 200 nL AAV2/5.hsyn.GcaMP6f.WPRE.SV40 virus or AAV2/5.syn.jGCaMP8s.WPRE (respectively: titer: 1.3*1012 gc/mL; a gift from Douglas Kim & GENIE Project: Addgene viral prep # 100837-AAV5 ...
-
bioRxiv - Developmental Biology 2024Quote: ... and cloned 5’ to 2xeGFP or 2xmCherry amplified from pHsp83-NLS-HA-2xPCP-2xGFP vector (Addgene #71243) (Halstead et al. ...
-
bioRxiv - Microbiology 2020Quote: The production of high titer Human sgRNA Brunello lentiviral library which contains 4 sgRNA per gene (15) (Addgene #73178), was performed by transfecting HEK293T cells in five 15 cm tissue culture plates using PEI (Polyethylenimin Linear ...
-
bioRxiv - Bioengineering 2020Quote: ... pCXLE-hMLN and pCXLE-hOCT3/4 that were a gift from Shinya Yamanaka (Addgene plasmid # 27078, 27079 and 27076), according to previously reported papers(80,81) ...
-
bioRxiv - Systems Biology 2023Quote: ... and pMD2G envelope plasmid (4 μg, a gift from Didier Trono (Addgene plasmid #12259; http://n2t.net/addgene:12259; RRID: Addgene_12259)) were transfected into HEK-293 T cells (ThermoFisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... Most CaMKII mice (n=4) were infused with AAV9-CaMKII-SomArchon-GFP (titer: 3.2×1012 GC/mL, Addgene #126942), and one CaMKII mouse was infused with AAV9-synapsin-SomArchon-GFP (titer ...
-
bioRxiv - Bioengineering 2023Quote: ... followed by addition of the plasmid cocktail containing 4 µg of pMD2.G (a gift from Didier Trono; Addgene plasmid # 12259 ...
-
bioRxiv - Microbiology 2023Quote: ... hGM-CSF and hIL-4 were produced from HEK293 cells stably transduced with pAIP-hGMCSF-co (Addgene no. 74168) or pAIP-hIL4-co (Addgene no ...
-
bioRxiv - Cell Biology 2023Quote: ... pLenti CMV GFP Hygro (656-4) was a gift from Eric Campeau and Paul Kaufman (Addgene plasmid # 17446; http://n2t.net/addgene:17446; RRID: Addgene_17446). pLenti CMV GFP Hygro (656-4 ...