Labshake search
Citations for Addgene :
2351 - 2400 of 2496 citations for 5 Nitro 1H benzo de isoquinoline 1 3 2H dione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... Immobilized proteins were eluted by incubation with 1 mL of 250 nM SENPEuB protease (expressed and purified from pAV286 (Addgene # 149333))74 overnight at 4° C ...
-
bioRxiv - Cancer Biology 2023Quote: The lentivirus shRNA plasmids targeting mouse RelA and Pkci were generated by cloning annealed oligos into AgeI and EcoRI sites of pLKO.1-hygro-ctrl plasmid (Addgene #24150). Following target sequences and oligos were utilized ...
-
bioRxiv - Developmental Biology 2023Quote: ... shortened to 19 bp length and flanked with BbsI overhangs. Corresponding oligonucleotides (Suppl. Table 1) were inserted into BbsI-digested pX330-U6- Chimeric_BB-CBh-hSpCas9 (obtained from Addgene, plasmid #42230) 35 to generate pX330- Ep400-Ex15 and px330-Kat5-Ex8 ...
-
bioRxiv - Microbiology 2023Quote: ... HUDEP-2 were transduced at an MOI <1 with lentivirus prepared from pXPR_101 (lentiCas9-blast, gift from Feng Zhang, Addgene plasmid 52962) and selected with blasticidin ...
-
bioRxiv - Cell Biology 2023Quote: ... CFP-GAI-MTM1 was made by inserting MTM1 from mCherry-FKBP-MTM1 after GAI in CFP-GAI(1-92) (gift from Takanari Inoue, Addgene # 37307). LysoYFP-GID1 was made by inserting Lyso from LysoGFP-Sac1 before YFP in YFP-GID1 (gift from Takanari Inoue ...
-
bioRxiv - Genetics 2024Quote: ... To determine MOI and approximation of appropriate viral volume we infected day 14 iGLUTs (0, 1, 2, 4, 8, 10, 16, 32, 64 µL) with control lentivirus (pLS-SV40-mP-EGFP; AddGene #137724) and harvested for 48hrs later ...
-
bioRxiv - Developmental Biology 2024Quote: ... Individual sgRNAs targeting sites 1-4 of the SABER array were cloned into 4 separate U6x:sgRNA plasmids (Addgene plasmids 64245-64248) as described previously52 ...
-
bioRxiv - Neuroscience 2024Quote: ... An intersectional approach was used for selective activation of mPFC to BLA projection using chemogenetics: 1) retrograde AAV encoding FlpO (0.3 μL, titer ≥ 7 x 1012 GC/ml, Addgene# 55637; RRID:Addgene_55637) were bilaterally injected into BLA (A-P ...
-
bioRxiv - Cancer Biology 2024Quote: Guide RNA (gRNA) sequences targeting neutral sphingomyelinases 1 & 2 and Rab27s a and b were cloned into a lentiCRISPR vector (Addgene (52961) 45 ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 × 106 cells were plated in 60 mm dishes for 24 hours followed by transfection with m6A-Tracer GFP (AddGene, 139403) and DAM-lamin B1 (AddGene ...
-
bioRxiv - Immunology 2024Quote: Stable Cas9 expression was established in human B-cell lines (WSU-FSCCL, HBL-1 and SUDHL5) using lentiviral transduction of lentiCas9-Blast (Addgene #52962). Cells were incubated with 10µg/ml polybrene (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2024Quote: ... 5% FBS,0.01% Sodium Pyruvate) were transfected according to manufacturer instructions using Lipofectamine 2000 with plasmids carrying HIV-1 Gag/Pol (pMDLg/pRRE Addgene: 12251), HIV-1 Rev (pRSV-Rev Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... mice were stereotaxically injected with an adeno-associated viral vector encoding a double-floxed inverted orientation GCaMP6f (pAAV-Syn-Flex-GCaMP6f-WPRE-SV40, titer: ∼ 1 × 1013 GC/mL, acquired from Addgene (#100833)) using Nanoject III (Drummond Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... The second crystallography construct (P1 21 1 form) was cloned into a pNIC vector with a His Sumo tag (Addgene: 215810) and residues (2 – 170 ...
-
bioRxiv - Microbiology 2024Quote: ... A gene block covering the spike portion of NYU-1 strain was ordered from IDT and cloned into pGSTag plasmid (Addgene, 21877) through Gibson Assembly (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: A non-targeting ‘scramble shRNA’ control sequence and two L1-ORF1-targeting shRNAs [9] were cloned into pLKO.1-TRC (Addgene #10878):
-
bioRxiv - Cell Biology 2024Quote: ... mScarlet-i-PLEKHA5WW was made by inserting the cDNA sequence encoding the tandem WW domain (residue 1-105) into the CMV-mScarlet-i-C1 vector (Addgene 85044) using BamHI and SalI ...
-
bioRxiv - Neuroscience 2024Quote: ... Site-directed integration into attP sites was achieved by co-injection of an attB-containing vector (400 ng µl-1) and pBS130 (encoding ΦC31 integrase under control of a heat shock promoter (Addgene #26290) (Gohl et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... a plasmid with the synapsin-1 promoter that controls the expression of the biosensor GCaMP6 and fused to the red fluorochrome mRuby2 (Addgene, # 50942); and hSyn-HyPer ...
-
bioRxiv - Molecular Biology 2024Quote: ... the sgRNA coding sequence (Supplementary Table 1) was cloned into pX459 V2.0 vector (a gift from Feng Zhang; Addgene plasmid 62988)63 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... with library plasmid amount corresponding to 1 plasmid per cell and 20 ug of base editor pCMV-T7-ABE8e-nSpCas9-P2A-EGFP (KAC978) (Addgene #185910). Genomic DNA was collected from cells 5 days after transfection.
-
bioRxiv - Molecular Biology 2024Quote: ... the rtTA3 gene fused to the blasticidin resistant marker (BlastR) was adapted from the pLenti CMV rtTA3 Blast (w756-1) plasmid (Addgene, 26429).
-
bioRxiv - Neuroscience 2024Quote: ... and two sgRNA targeting sequences against BORCS7 (1: CGCGATTACGTCAGTACCAC, 2: GATTACGTCAGTACCACAGG) were cloned into the lenti-CRISPR v2 plasmid (Addgene 52961) following the Zhang Lab protocol (https://media.addgene.org/data/plasmids/52/52961/52961-attachment_B3xTwla0bkYD.pdf) ...
-
bioRxiv - Plant Biology 2024Quote: ... ONAC024 and SS1/ ONAC025 were amplified using gene-specific primers (Supplemental Table 1) and cloned in pGADT7-GW/pGADT7-AD (Addgene, USA) through Gateway® cloning technology ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV9-hSyn-GRABNE2h was co- injected with AAV9-CAG-tdTomato (stocks at 1-2 x 1013 copies/mL, Addgene, #59462-AAV9).
-
bioRxiv - Microbiology 2024Quote: ... from cDNA obtained from RPE-1 cells and cloned into pReplacer or the tet-on lentiviral vector pLIX-402 (Addgene #41394) using PstI restriction sites ...
-
bioRxiv - Plant Biology 2024Quote: ... 1.25 μL of loaded pA-Tn5 were added to 1 μL of a plasmid at 250 ng/μL (we used a derivative of pAGM65879 [Addgene #153214]), 1 μL NEBuffer 3.1 (NEB #B6003S) ...
-
bioRxiv - Bioengineering 2024Quote: ... The selected sequences (Supplementary Table 1) were chemically synthesized and cloned into BbsI-digested pC0043 (encoding crRNA for dPsbCas13b) (Addgene #103862) or pXR004 (encoding precursor crRNA for dRfxCas13d ...
-
bioRxiv - Bioengineering 2024Quote: ... was used in conjunction with one of three different RepCap plasmids (7m8,5 Addgene, #64839; pAAV-DJ,6 Cell Biolabs, VPK-420-DJ; pAAV2/1, Addgene, #112862), and a self-complementary AAV cargo vector (see design below ...
-
bioRxiv - Cancer Biology 2024Quote: ... and pCDH-FLT3L-CAR transferring lentiviral vector as previously described.9 Immortal THP-1 monocytic cells were first transduced with mCherry-encoding lentivirus (Addgene #176016) and sorted by FACS (BD FACSaria FUSION) ...
-
bioRxiv - Cancer Biology 2021Quote: ... A 370 bp fragment of genomic DNA containing miRNA miR-34c was cloned into the Xho I and Mlu I restriction sites of the pLKO.1 vector (Addgene plasmid #52920) to express miR-34c (32) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1-cell stage embryos were injected with a 1 nl mix of approximately 56-60 pg sgRNA and 190 pg cas9 mRNA (Addgene plasmid #47322). Mosaic embryos were raised to adulthood and crossed with Tupel Long fin (TL ...
-
Rab35 Governs Apicobasal Polarity Through Regulation of Actin Dynamics During Sprouting AngiogenesisbioRxiv - Developmental Biology 2022Quote: ... The destination vector used in this study was pLenti CMV Neo DEST (705-1) (gift from Eric Campeau & Paul Kaufman; Addgene plasmid #17392). Once validated ...
-
bioRxiv - Cancer Biology 2020Quote: ... To generate inducible CRISPR-Cas9 GFPT2 KO cell lines, parental cells (H460, H157, Calu-1) were first infected by pCW-Cas9 plasmid (Addgene plasmid #50661), sorted by puromycin selection ...
-
bioRxiv - Cell Biology 2020Quote: ... and subcloned into pcDNA3.1-MCSBirA(R118G)-HA vector (a gift from Kyle Roux, Addgene plasmid #36047; http://n2t.net/addgene:36047; RRID:Addgene_36047, (Roux et al, 2012)) ...
-
bioRxiv - Cancer Biology 2021Quote: ... KRT14 mouse and Human ShRNA sequence were cloned in the 3rd generation transfer plasmid pLKO.1 TRC cloning vector (Addgene cat # 10878) between unique AgeI and EcoRI restriction sites downstream of the U6 promoter ...
-
bioRxiv - Neuroscience 2020Quote: AAV-SYN-flex-PSAM4-GlyR-IRES-EGFP was a gift from Scott Sternson (Addgene viral prep # 119741-AAV5; http://n2t.net/addgene:119741; RRID:Addgene_119741; >1×1013 vg/ml). Control virus was AAV1-EF1α-DIO-eYFP (>1×1013 vg/ml ...
-
bioRxiv - Neuroscience 2020Quote: ... the promoter was substituted by mDlx enhancer sequence from pAAV-mDlx-GFP-Fishell-1 (a gift from Gordon Fishell, Addgene plasmid # 83900) and cDNA encoding mCherry was further inserted into multicloning site 21 ...
-
bioRxiv - Neuroscience 2020Quote: ... two viruses were injected in the same animal: AAV1-Syn-NES-jRGECO1a-WPRE-SV40 (Addgene; 1 × 1013 GC/mL titer, 294.4 nL) in Cg1/M2 ...
-
bioRxiv - Plant Biology 2021Quote: ... pICH47811-pTCSn::nls:tGFP (position 2) was cloned together with pICH47802-pIPT3::nls:tdTOMATO::t35S (position 1) in the final plant expression vector pAGM4673 (Addgene, catalog number: 48014).
-
bioRxiv - Plant Biology 2021Quote: ... was cloned together with pICH47802-p35S::ER:tdTOM::tNOS selection marker (position 1) in the final plant expression vector pAGM4673 (Addgene, catalog number: 48014). For simultaneous live imaging ...
-
bioRxiv - Neuroscience 2020Quote: The GECI AAV2/1-Syn-FLEX-mRuby2-CSG-P2A-GCaMP6m-WPRE-SV40 (titer: 2.9 x 1013 GC per ml, Addgene accession no. 102816) in combination with the Cre recombinase AAV2/1.CamKII0.4.Cre.SV40 (titer ...
-
bioRxiv - Genomics 2021Quote: ... 100 ng of a synthetic gblock encoding the the HS-CRM8-TTRmin module38 upstream of dsRed (Integrated DNA Technologies) and 1 μg of sgOpti (gift from Eric Lander and David Sabatini, Addgene plasmid #85681)39 ...
-
bioRxiv - Cell Biology 2021Quote: ... A control cell line was generated by infecting U2OS cells stably expressing a non-targeting sgRNA (above) with the lentivirus vector pLKO.1-blast-Scramble (Addgene, cat# 26701) expressing a non-targeting shRNA sequence and selected with 15µg/ml blasticidin for 7 days ...
-
bioRxiv - Cell Biology 2020Quote: WT and JMS hiPSCs were transduced with lentiviruses encloding for the non-specific control short-hairpin RNA (shControl; pLKO.1 puro (Addgene ID: 8453)) or the p53 targeting shRNA (shp53 pLKO.1 puro shRNA (Addgene ID ...
-
bioRxiv - Biochemistry 2022Quote: ... and CstF77 (Uniprot Q12996-1) were cloned into ligation-independent cloning (LIC) expression vectors 1B (gift from Scott Gradia, Addgene plasmid #29653), 1M (Addgene plasmid #29656) ...
-
bioRxiv - Neuroscience 2022Quote: ... P0-1 pups received the viral construct AAV9-hSyn-hChR2(H134R)-EYFP (200 µl at titer ≥ 1×10¹³ vg/mL, #26973-AAV9, Addgene, MA, USA) into the OB and the retrograde virus AAVrg-CamKIIα-mCherry (80 µl at titer ≥ 7×10¹² vg/mL ...
-
High-performance GPCR optogenetics based on molecular properties of animal opsins, MosOpn3 and LamPPbioRxiv - Biochemistry 2022Quote: ... The vector backbone containing SL1 and GFP was obtained by digestion of the plasmid [pEM1 = flp-21::LoxPStopLoxP::npr-1 SL2 GFP] (Addgene plasmid # 24033)65 with NotI and KpnI ...
-
bioRxiv - Developmental Biology 2021Quote: The pU6-chiRNA:sgRNA plasmid was obtained by incorporating the sgRNA sequence (obtained by annealing phos-gRNA-F and phos-gRNA-R, Supplementary Table 1) into pU6- BbsI-chiRNA (Addgene plasmid # 45946) (22 ...
-
bioRxiv - Neuroscience 2020Quote: ... CRISPR guide RNA sequences (sgRNA#1 TTGTTGCCCAGGGTTTAACA and sgRNA#2 CCCATCCCCGGCACCGGGTC) targeting the mouse Nlk locus were cloned into pSpCas9n(BB)-2A-Puro (Addgene #62987; PX462). Cells were transfected with gRNA and Cas9n-expressing plasmids using Lipofectamine 2000 and successfully transfected cells were selected with 3μg ml-1 puromycin for two days ...