Labshake search
Citations for Addgene :
2301 - 2350 of 2537 citations for 2 1H Imidazol 1 yl 6 methyl 4 pyrimidinemethanamine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... and annealed and ligated in the pLKO.1 Hygro linearized backbone (a gift from Bob Weinberg, plasmid #24150 on Addgene). Stbl3 bacteria were heat-shocked to uptake ligated plasmid ...
-
bioRxiv - Cancer Biology 2024Quote: ... to target NCL translation start site and the targeting sequence was cloned into pX330-U6-Chimeric_BB-CBh-hSpCas9-hGem (1/110) (Addgene#71707)103 according to standard protocols104 ...
-
bioRxiv - Neuroscience 2024Quote: ... Oertner) or AAV2/1-EF1a-DIO-iChloC-2A-dsRed (5x1013 GC/ml; Addgene plasmid #70762, a gift from T. Margrie). For calcium imaging experiments ...
-
bioRxiv - Plant Biology 2024Quote: ... The CDS of the prey protein (CLPS1) was cloned and inserted into the pET His6 MBP TEV LIC cloning vector (1 M) (#29656, Addgene) cloning vector to generate fusion constructs with an MBP tag ...
-
bioRxiv - Molecular Biology 2024Quote: ... A guide RNA sequence was selected to target exon 1 of MTU1 and cloned into LentiCRISPR v2 (a gift from Feng Zhang, Addgene plasmid # 52961 ...
-
bioRxiv - Biochemistry 2024Quote: ... A recombinant expression construct encoding the DOT1L catalytic domain (Uniprot Q8TEK3; residues 1-420) was purchased from AddGene (AddGene #36196). A recombinant expression construct encoding the Haspin kinase domain (GSG2 ...
-
bioRxiv - Neuroscience 2024Quote: ... Rats were placed under isoflurane anesthesia and received unilateral or bilateral infusions of AAV1-Syn-Flex-GCaMP6f-WPRE-SV40 (1×1013vg/mL, Addgene) to allow for Cre-dependent expression of GCaMP in the VTA (AP -5.5 mm ...
-
bioRxiv - Neuroscience 2024Quote: A small craniotomy was drilled above the right Anterior Cingulate Cortex (AP: +1, ML: -0.3, DV: -0.9) and 0.2μl of AAV1-CAG-tdTomato (59462-AAV1, Addgene, 5×10¹² vg/mL) was injected at a rate of 0.05μl/min ...
-
bioRxiv - Neuroscience 2024Quote: ... sequence along with the P2A sequence (2A peptide from porcine teschovirus-1 polyprotein) at the 3’ end was obtained via PCR from Addgene plasmid #129102 and fused in-frame with the mTurquoise2 DNA sequence in the same plasmid backbone as the pAAV-hSyn-mTurquoise2 plasmid ...
-
bioRxiv - Neuroscience 2024Quote: ... At P1-P2 pups were anaesthetized with Iso-fluorane and intra-cortically injected with 1 ul of a viral solution containing (AAV-EF1A-Gephyrin.FingR-GFP-CCR5TC – Addgene#125692 and AAV-CAG-tdTomato - Addgene# 59462) into layers 2/3 using a Drummond Nanojet microinjector according to the manufacturer’s protocol.
-
bioRxiv - Neuroscience 2024Quote: ... with 1 µl pAAV-mDlx-GFP-Fishell-1 (83900-AAV1), kindly shared by Dr. Gordon Fishell (Dimidschstein, Chen et al. 2016) and purchased from Addgene.
-
bioRxiv - Cell Biology 2024Quote: WT (M63.1: pMG-INV 36: iCas9.302) abl pre-B cells with chromosomally integrated pMG-INV reporter and pCW-Cas9 (Addgene #50661) were described previously (29) ...
-
bioRxiv - Immunology 2024Quote: ... the oligo targeti ng NAIP (5’-CCGGGCCGTGGTGAACTTTGTGAATCTCGAGATTCACAAAGTTCACC ACGGCTTTTTG-3’ and 5’-AATTCAAAAAGCCGTGGTGAACTTTGTGAATCTCGAGA TTCACAAAGTTCACCACGGC-3’) was cloned into pLKO.1 puro (8453, Addgene), w hich was then used for lentiviral construct as above ...
-
bioRxiv - Developmental Biology 2024Quote: Approximately 1 × 106 trisomic proband iPS cells were transiently co-transfected with a plasmid that expressed a gRNA (Addgene: 229941) specific to the chromosome 8 centromere region and the mCherry-KNL1Mut-dCas9 plasmid ...
-
bioRxiv - Cancer Biology 2024Quote: ... gRNA was cloned into the Bbs1 restriction site of the pX330-U6-Chimeric_BB-CBh-hSpCAas9-hGem (1/110) vector (Addgene #71707) before transformation into NEB® 5-alpha Competent E ...
-
bioRxiv - Cell Biology 2024Quote: ... 100,000 HeLa M cells were plated per well in a 6-well plate and transfected the following day at a ratio of 1:15 with the pEGFP-Puro plasmid (45561; Addgene) and gRNA-containing plasmid (pX330A-1×2) ...
-
bioRxiv - Cell Biology 2024Quote: ... of ArfGAP1 was amplified from pGEX-6P-1-hs-ALPS1-ALPS2-mCherry (a gift from Philipp Niethammer (Addgene plasmid # 187114; RRID: Addgene_187114); (Shen et al. ...
-
bioRxiv - Cell Biology 2024Quote: PS-DKO cells were transfected with the truncated mature form of SREBP2 (2xFLAG-SREBP2, aa 1-482, Addgene plasmid #26807), which is targeted to the nucleus where it activates cholesterol biosynthesis gene programs ...
-
bioRxiv - Cancer Biology 2024Quote: 3x105 parental and clonally derived Cas9-expressing OCI-AML2 or PANC-1 cells were infected with pXPR_011 (Addgene Plasmid #59702) virus as described above ...
-
bioRxiv - Cancer Biology 2024Quote: Lentivirus was produced by cotransfection of a lentiviral vector (pLJM1, pLVX, pLKO.1) and the packaging plasmids psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Cancer Biology 2021Quote: ... The shRNAs targeting HDAC1 (5′-CTATGGTCTCTACCGAAAA-3′) and HDAC3 (5′-GCATTGATGACCAGAGTTA-3′) were cloned into pLKO.1-TRC lentiviral vector (Addgene, #10878). For generation of lentivirus ...
-
bioRxiv - Cell Biology 2020Quote: FACS EPCAM+ stromal depleted organoids at d14 were infected with lentivirus at an estimated MOI of 0.9 according to Van Lidth de Jeude et al.72 with third generation lentiviral vectors (PGK-GFP T2A Puro, SBI cat# CD550A-1; mCherry modified from pLentiCRISPRv1 (Addgene #49545) to incorporate an EF-1a-mCherry P2A Puro cassette ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Site-directed integration into attP sites was achieved by co-injection of an attB-containing vector (400 ng µl-1) and pBS130 (encoding phiC31 integrase under control of a heat shock promoter (Addgene #26290) [73]) ...
-
bioRxiv - Molecular Biology 2020Quote: ... the sequence encoding the native signal peptide and ECD of GPR56 (amino acids 1-400) was subcloned from pCAG-hGPR56-IRES-GFP (from Christopher A Walsh, Addgene 52297) into pCEP4 (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... The first fragment was amplified using p15-Cam-F and p15-Cam-R (Table 1) from the plasmid pEVOL-pBpF (Addgene #31190), and the second fragment was obtained from the pBAD/HisB vector (Invitrogen ...
-
Rab35 Governs Apicobasal Polarity Through Regulation of Actin Dynamics During Sprouting AngiogenesisbioRxiv - Developmental Biology 2022Quote: ... and Linearized pShuttle-CMV plasmids were transformed into the final viral backbone using electrocompetent AdEasier-1 cells (gift from Bert Vogelstein; Addgene, #16399). Successful incorporation of pShuttle-CMV construct into AdEasier-1 cells confirmed via digestion with PacI (ThermoFisher) ...
-
bioRxiv - Cell Biology 2020Quote: Knockdown of TPM1 was performed using the pLKO.1 plasmid lentiviral backbone (a kind gift from Bob Weinberg, Addgene plasmid #8453) either encoding an shRNA with sequence complementary to TPM1 (shTPM1 ...
-
bioRxiv - Bioengineering 2021Quote: ... The nCas9(D10A) was generated by the PCR method using previously optimized Cas9 as a template (Level 1 hCas9 module, Addgene #49771). Desired sgRNA sequence was PCR amplified using plasmid pICH86966::AtU6p::sgRNA_PDS (Addgene #46966 ...
-
bioRxiv - Biochemistry 2021Quote: ... shRNA targeting mSARM1 (5’-CCGGCTGGTTTCTTACTCTACGAATCTCGAGATTCGTAGAGTAAGAAACCAGTTTTTG-3’) or the scrambled shRNA (5’-CCGGCCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGGTTTTTG-3’) were inserted to pLKO.1-puro (Addgene, #8453) with EcoRI and AgeI ...
-
bioRxiv - Cell Biology 2021Quote: The components for each of the individual optogenetic sensors were first assembled in Level 1 destination vectors included in the MoClo Toolkit (Addgene #1000000044) by Golden Gate (GG ...
-
bioRxiv - Biochemistry 2021Quote: Expression cassette comprising of genes encoding PEPCK along with 1 kb of its promoter was cloned into pIB3 vector (cat # 25452, Addgene, USA) and expressed in P ...
-
bioRxiv - Cell Biology 2021Quote: ... Mito-mCh-1×FLAG and Mito-mCh-smFLAG were constructed by ligating 1×FLAG synthesized by overlapping PCR and smFLAG amplified from smFLAG-KDM5B-24×MS2 (Addgene # 81084) with previously built Mito-mCh-1×HA cut by BglII and BamHI through Gibson Assembly.
-
bioRxiv - Cell Biology 2021Quote: ... U2OS cells seeded on 35mm MatTek chambers with 70% confluency were loaded with 1 µg of smFLAG-KDM5B-24×MS2 (Addgene #81084), 0.5 µg of anti-FLAG FB-GFP and 130 ng of purified MCP-HaloTag protein by bead loading (Cialek et al. ...
-
bioRxiv - Cell Biology 2021Quote: A codon-optimised sequence for full-length USP7 (USP7FL) was cloned into pGEX6p-1 using BamHI/NotI restriction sites (Addgene, #63573). Mutations at S18 were introduced using partially overlapping primers with Phusion Flash polymerase (Thermo Fisher Scientific) ...
-
bioRxiv - Systems Biology 2020Quote: ... We then used lentivirus to stably integrate pCMV-DHB-mCherry or pCMV-mCherry-Geminin(1-110)-P2A-mCitrine-Cdt1(30-120) in pLenti-Puro (Addgene: 39481). Cells were screened with puromycin and sorted by FACS to generate monoclonal cell lines.
-
bioRxiv - Neuroscience 2020Quote: Cortical pyramidal neurons (CPN)s in WT and YAC128 cultures were labeled by transfecting a subset of neurons (1 of 2.7 million) with a cytoplasmic green fluorescent protein (GFP) (Addgene plasmid 37825) at the time of platting ...
-
bioRxiv - Genomics 2021Quote: ... Corresponding DNA oligonucleotides with BbsI overhangs (sequences are listed in Suppl. Table 1) were annealed and ligated with pre-digested pSPgRNA plasmid (Addgene, # 47108). HEK293T17 cells (ATCC ...
-
bioRxiv - Molecular Biology 2022Quote: FLAG-NKX2-1 or FLAG-GFP open reading frame (ORF) was cloned into pLEX_306 (a gift from David Root, Addgene plasmid #41391). Cells stably expressing Cas9 were generated by infection with the lentiCas9-Blast plasmid (Addgene # 52962 ...
-
bioRxiv - Cell Biology 2022Quote: ... The Capping Protein (F-actin-capping protein subunit alpha-1 and F-actin-capping protein subunit beta) plasmid was a gift from Antoine Jégou & Guillaume Romet-Lemonne (Addgene plasmid #89950).
-
bioRxiv - Cancer Biology 2022Quote: ... The double strand DNA coding HMGN5 shRNA and STAT3 shRNA were synthesized by Sangon Biotech (Shanghai, China) and cloned into the lentiviral vector pLKO.1-Puro (Addgene, 8453).
-
bioRxiv - Cell Biology 2022Quote: ... a 20bp guide sequence targeting the 5’ end of WNK1 exon 1 was ligated to the BbsI site of PX459 (Addgene #62988). In addition ...
-
bioRxiv - Immunology 2022Quote: Lentiviruses pseudotyped with HIV-1 env were prepared by transfecting the Lenti-X 293T cells with pCMV-dR8.3 Δvpr (Addgene plasmid #8455), pLOX-CW-tdTomato ...
-
Targeted attenuation of elevated histone marks at SNCA alleviates α-synuclein in Parkinson’s diseasebioRxiv - Neuroscience 2020Quote: ... The catalytically active domains of JARID1A enzyme (1-797 amino acids) was amplified from pcDNA3/HA-FLAG-RBP2 plasmid (Addgene #14800), a gift from William Kaelin (Klose et al ...
-
bioRxiv - Microbiology 2021Quote: ... hairpin loop sequence and shRNA sequence were synthesised (IDT technologies) and annealed oligos cloned into pLKO.1 TRC cloning vector (Addgene #10878) using the unique Age1/EcoR1 sites ...
-
bioRxiv - Neuroscience 2020Quote: Plasmid Cry2olig-mCherry-tau 1-441 was prepared by inserting DNA fragment encoding the full length tau into the linearized Cry2olig-mCherry (Addgene 60032) backbone at the C-terminus of mCherry using Gibson assembly® Cloning kit (New England BioLab Int.) ...
-
bioRxiv - Developmental Biology 2020Quote: ... MCP-TagRFPT constructs were assembled by replacing the eGFP fragment of pNosPE_MCP-eGFP using NheI/BamHI with the TagRFPT coding sequence amplified by PCR (supplementary table 1) from TagRFP-T-Rabenosyn-5 (Addgene 37537). MCP-TagRFPT-NLS was generated by insertion of the TagRFPT-NLS coding sequence into pNosPE_MCP-eGFP with NEBuilder® HiFi DNA Assembly Master Mix (primers listed in supplementary table 1).
-
bioRxiv - Molecular Biology 2020Quote: ... The annealed oligos were diluted (1:200) and cloned into pLV hU6-sgRNA hUbC-dCas9-KRAB-T2a-Puro (encoding dCas9-KRAB; Addgene # 71236) using a Golden Gate Assembly strategy (containing ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tetracycline-inducible TET-shRB1 and constitutive shRB1 constructs were created by integrating validated siRNA sequences GAAAGGACATGTGAACTTA (63) and GAACGATTATCCATTCAAA (64) targeting human RB1 (shRB1) into TET-pLKO.1-Puro vector (Addgene #21915) and pLKO.1-Puro vector ...
-
bioRxiv - Cancer Biology 2021Quote: ... plasmids were created by integrating validated siRNA sequences CCTGTCAGGAAACTGTATGAT (62) and AATGGCCATCAGAACGGACTT targeting human ESRRG (shESRRG) into pLKO.1-Puro vector (Addgene #8453). Non-specific siRNA sequence AACAGCCACAACGTCTATATC or siRNA sequence CAACAGCCACAACGTCTATAT targeting GFP were used as controls for shRNA ...
-
bioRxiv - Neuroscience 2021Quote: ... Twenty hemizygous ChAT-Cre mice were bilaterally injected with Cre-dependent inhibitory DREADD fused with mCherry reporter AAV8-hsyn-DIO-hM4Di-mCherry (1×1013 VG/ml; Addgene, 44362) or control virus (AAV8-hsyn-DIO-mCherry ...