Labshake search
Citations for Addgene :
2201 - 2250 of 2458 citations for 7 Methylimidazo 1 2 a pyridine 6 boronic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Ribonuclease Inhibitor and Angiogenin collaboratively regulate cell-type-specific global translationbioRxiv - Biochemistry 2024Quote: RNH1-KO K562 cells were infected with lentiviruses expressing ANG (pLenti CMV Blast GFP-ANG) or the empty vector pLenti CMV Blast DEST (706-1, Addgene) as previously described 52 ...
-
Ribonuclease Inhibitor and Angiogenin collaboratively regulate cell-type-specific global translationbioRxiv - Biochemistry 2024Quote: ... the human Angiogenin (ANG) full coding sequence (ORIGEN RC 208874) was cloned into the entry vector pENTR4-GFP-C1 (W392-1, Addgene) and then recombined into the destination vector pLenti CMV Blast DEST (706-1 ...
-
bioRxiv - Cancer Biology 2024Quote: ... This fragment was subcloned by restriction (BamHI and XhoI) and ligation into the lenti-vector expression backbone plasmid pLenti-CMV-Blast-empty-(w263-1) (Addgene). Sequence integrity was validated with Sanger sequencing ...
-
bioRxiv - Molecular Biology 2024Quote: ... Annealing reactions were diluted 1:10 with water and then 1µL was used to ligate into 100ng of BsmBI digested pLentiGuidePuro vector (Addgene #52963) in 1x T4 DNA Ligase Buffer ...
-
bioRxiv - Neuroscience 2024Quote: ... rats received a bilateral prelimbic (PrL; AP: +2.8, ML: +/-0.6, DV: -3.8) infusion of AAV2.CamKII::hChR2(H134R)-EYFP (Addgene, titer: ∼1×1013) and a bilateral infusion of either AAV2.CMV::nNOS-shRNA-EGFP or AAV2.CMV::luciferase-shRNA-EGFP combined with an AAV2.hsyn::DIO-mCherry (Addgene ...
-
bioRxiv - Molecular Biology 2024Quote: ... Two gRNAs targeting Exon 1 (targeting sequence GGGCGCGCTACCTGTCTCCG) and Exon 10 (targeting sequence GAACTGGACTTTGAAAGAGG) were cloned in BPK1520 (Addgene #65777) and transfected with Amaxa Nucleofector II together with BPK4410 ...
-
bioRxiv - Genetics 2024Quote: ... pLenti-CMV-HA-HHIP lentiviral expression plasmid was generated by subcloning the appropriate human HHIP cDNA PCR fragment into pLenti-CMV Blast (659–1) (Addgene). HA-tag was inserted into human HHIP cDNA after Ala 23 ...
-
bioRxiv - Immunology 2024Quote: ... One microliter of 1:100 diluted product was used for golden gate cloning into lentiCRISPR v2-Puro (Addgene plasmid #52961) using 11 cycles of 5 minutes T4 ligase ligation at 16 °C and 5 minutes of BsmbI digestion at 37 °C ...
-
bioRxiv - Biophysics 2023Quote: Fusion constructs with pTREtight2 vectors were co-transfected with reverse tetracycline-controlled transactivator 3 (pLenti CMV rtTA3 Hygro (w785-1)) plasmid (Addgene) in the presence of doxycycline (Clontech) ...
-
bioRxiv - Cell Biology 2023Quote: ... We generated monoclonal U2OS cell lines expressing the following fluorescent plasmids: 1) ptfLC3B was a gift from Tamotsu Yoshimori (Addgene plasmid #21074 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... A human elongation factor 1 (EF1) promoter was introduced using a Gateway att4-att1 Entry clone (Addgene, Watertown, MA, #162920). Final expression clones were verified by restriction analysis and maxiprep DNA was prepared using the Qiaprep Maxiprep kit (Qiagen ...
-
bioRxiv - Cancer Biology 2023Quote: Plasmids for CRISPR/Cas9-mediated Ilk knockout were generated by cloning oligonucleotides encoding 2 sgRNAs targeting the Ilk gene (1) between the BbsI sites of the eSpCas9(1.1) plasmid76 (a gift from Feng Zhang; Addgene; #71814). For Ilk re-expression ...
-
bioRxiv - Genomics 2023Quote: ... RRID:Addgene_85451)20. We replaced the hU6-sgRNA cassette with the mU6-sgRNA cassette from pMK1334 (ref. 1) (Addgene plasmid #127965, RRID:Addgene_127965) by restriction cloning between sites MluI and XbaI ...
-
bioRxiv - Biochemistry 2023Quote: ... 8 µg psPAX2 packaging plasmid DNA and 1 µg pMD2.G envelope plasmid DNA (both gifts from Didier Trono, Addgene plasmid no ...
-
bioRxiv - Neuroscience 2023Quote: ... we bilaterally (2-2.5 mm lateral and 3.5-4.0 mm posterior from Bregma) injected 1 uL of the conditional GtACR2 virus (AAV5-hSyn1-SIO-stGtACR2-FusionRed, Addgene #105677), or 1uL saline injection for controls ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1% Pen/Strep and 0,5mg/ml Geneticin) by transient transfection of transfer vector 2nd generation packaging plasmid-psPAX2 (Addgene #12259) and envelope vector-pMD2 (Addgene #12260 ...
-
bioRxiv - Neuroscience 2023Quote: ... Cortical injections to adult C57BL/6J mice additionally included a 1:300 dilution of rAAVretro-hSyn-Cre (Addgene #105553-AAVrg) to induce expression of Voltron2-ST and a 1:150 dilution of AAV9-hSyn-Cheriff-EGFP (Addgene plasmid #51697 ...
-
bioRxiv - Plant Biology 2023Quote: The full-length or 3TPR-truncated cDNA sequence of SPY was amplified from Arabidopsis cDNA with appropriate primers (listed in Supplemental Table 1) and cloned into the pET28sumo vector (Addgene?), which adds a 6xHis-SUMO tag to the N-terminus of the protein of interest ...
-
bioRxiv - Microbiology 2023Quote: ... Both rIIB and rexAB were cloned under the IPTG-inducible PLlacO-1 promoter into the vector pBbA6c-RFP50 (Addgene 35290) using NEBuilder HiFi DNA Assembly ...
-
bioRxiv - Cell Biology 2022Quote: ... plasmids from the step 1 were cloned into pLV GG hUbC-EGFP (84034, Addgene; dsRED was replaced with EGFP from 1168, Addgene) by Golden gate assembly method.
-
bioRxiv - Genomics 2023Quote: ... The pLV-Myf5Promoter-GFP plasmid was built by insertion of two sequences in a pLKO.1 plasmid backbone (Addgene #10878). The Myf5-promoter sequence was added at NdeI and KpeI cutting sites and the CRE-GFP sequence was added at SpeI and XhoI restriction sites using a T4 DNA ligase (NEB #M0202L) ...
-
bioRxiv - Cell Biology 2023Quote: ... Ras GTPase-activating protein-binding protein 1 (G3BP1) phage UbiC G3BP1-GFP-GFP was a gift from Jeffrey Chao (Addgene plasmid # 119950 ...
-
bioRxiv - Bioengineering 2023Quote: ... The entire tissue culture (between DIV3 and DIV5) was transfected with 1 µL AAV1-hSyn1-GCaMP6f-P2A-nls-dTomato virus (Addgene viral prep #51085-AAV1 ...
-
bioRxiv - Cell Biology 2022Quote: ... MLKL gene and its truncated version MLKL(1-182) were amplified by standard PCR from pRetrX-TRE3G-hMLKL-Venus (Addgene_106078) using primers MLKL_Fw and MLKL_Rv for the first ...
-
bioRxiv - Physiology 2024Quote: cDNA of the canonical NR4A3 transcript (NR4A3-203; NM_006981.4) was synthesised into a modified pLenti CMV Puro DEST (w118-1) vector (Addgene plasmid #17452) by GENEWIZ (Azenta Life Science ...
-
bioRxiv - Neuroscience 2023Quote: ... of adeno-associated viruses encoding the genetically-encoded calcium indicator GCaMP6s and mRuby2 as a structural marker under the control of the synapsin 1 promoter (pAAV-hSyn1-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA, cat. no. 50942-AAV1, Addgene) and slowly lowered to ∼350 µm below the surface of the exposed brain with an HO-10 hydraulic micromanipulator (Narishige) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Sequences encoding Ifi205 ORF and Ifi205K364ER299E ORF were amplified by PCR then subcloned between the BamHI and EcoRI restriction sites of pGEX-6P-1(Addgene). Ifi205 proteins were expressed as GST-Ifi205-FLAG-fusions in the E ...
-
bioRxiv - Neuroscience 2023Quote: ... two gRNAs designed to target exon 1 of ZNF91 [24] were cloned and inserted into pX330-SpCas9-HF1 (Addgene #108301). In addition to the gRNAs ...
-
bioRxiv - Cancer Biology 2023Quote: ... For each microgram crude eccDNA we spiked in 1 ng pUC1932 (was a gift from Joachim Messing, Addgene plasmid # 50005; RRID: Addgene_50005) and 1 ng egfr fragment to generate crude circular DNA mixture.
-
bioRxiv - Cancer Biology 2023Quote: ... we designed single guide RNAs to target the exon 1 of the human Per2 gene and subcloned it into the PX459 vector (Addgene) to obtain the PX459-Per2 plasmid ...
-
bioRxiv - Neuroscience 2024Quote: ... Oertner) or AAV2/1-EF1a-DIO-iChloC-2A-dsRed (5x1013 GC/ml; Addgene plasmid #70762, a gift from T. Margrie). For calcium imaging experiments ...
-
bioRxiv - Molecular Biology 2024Quote: ... A guide RNA sequence was selected to target exon 1 of MTU1 and cloned into LentiCRISPR v2 (a gift from Feng Zhang, Addgene plasmid # 52961 ...
-
bioRxiv - Neuroscience 2024Quote: ... Each eye was intravitreally injected with 1 μL of AAV2-hSyn-DIO-mCherry (∼8 x 1012 GC/mL, cat. #: 50459-AAV2, Addgene) using a custom Hamilton syringe (Borghuis Instruments ...
-
bioRxiv - Neuroscience 2024Quote: ... Each eye was intravitreally injected with 1 μL of AAV2-hSyn-DIO-hM3Gq-mCherry (∼8 x 1011 GC/mL, Addgene) using a custom Hamilton syringe (Borghuis Instruments ...
-
bioRxiv - Neuroscience 2024Quote: Rats were anesthetized with isoflurane (induction: 4%; maintenance: 1–2.5%) and received either AAV8-hSyn-hM4Di-mCherry (Addgene #50475-AAV8) or AAV8-hSyn-mCherry (Addgene #114472-AAV8) ...
-
bioRxiv - Biochemistry 2024Quote: ... A recombinant expression construct encoding the DOT1L catalytic domain (Uniprot Q8TEK3; residues 1-420) was purchased from AddGene (AddGene #36196). A recombinant expression construct encoding the Haspin kinase domain (GSG2 ...
-
bioRxiv - Cancer Biology 2024Quote: ... to target NCL translation start site and the targeting sequence was cloned into pX330-U6-Chimeric_BB-CBh-hSpCas9-hGem (1/110) (Addgene#71707)103 according to standard protocols104 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and annealed and ligated in the pLKO.1 Hygro linearized backbone (a gift from Bob Weinberg, plasmid #24150 on Addgene). Stbl3 bacteria were heat-shocked to uptake ligated plasmid ...
-
bioRxiv - Plant Biology 2019Quote: ... DNA-oligonucleotides (Figure 2-source data 1) containing the specific gRNA sequence were synthesised and used to amplify the full gRNA from a template plasmid (AddGene #46966). Using Golden Gate cloning40 each gRNA was then recombined in a L1 vector downstream of U6 promoter39 ...
-
bioRxiv - Cancer Biology 2021Quote: ... The shRNAs targeting HDAC1 (5′-CTATGGTCTCTACCGAAAA-3′) and HDAC3 (5′-GCATTGATGACCAGAGTTA-3′) were cloned into pLKO.1-TRC lentiviral vector (Addgene, #10878). For generation of lentivirus ...
-
bioRxiv - Cell Biology 2020Quote: FACS EPCAM+ stromal depleted organoids at d14 were infected with lentivirus at an estimated MOI of 0.9 according to Van Lidth de Jeude et al.72 with third generation lentiviral vectors (PGK-GFP T2A Puro, SBI cat# CD550A-1; mCherry modified from pLentiCRISPRv1 (Addgene #49545) to incorporate an EF-1a-mCherry P2A Puro cassette ...
-
bioRxiv - Developmental Biology 2021Quote: For mammalian 2-hybrid assays 2.15 x 105 HEK293 or 4 x 105 A375 cells were transiently transfected with 1 µg firefly luciferase reporter plasmid (5xGAL4-TATA-luciferase, Addgene, 46756) (Sun et al ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Site-directed integration into attP sites was achieved by co-injection of an attB-containing vector (400 ng µl-1) and pBS130 (encoding phiC31 integrase under control of a heat shock promoter (Addgene #26290) [73]) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The first fragment was amplified using p15-Cam-F and p15-Cam-R (Table 1) from the plasmid pEVOL-pBpF (Addgene #31190), and the second fragment was obtained from the pBAD/HisB vector (Invitrogen ...
-
Rab35 Governs Apicobasal Polarity Through Regulation of Actin Dynamics During Sprouting AngiogenesisbioRxiv - Developmental Biology 2022Quote: ... and Linearized pShuttle-CMV plasmids were transformed into the final viral backbone using electrocompetent AdEasier-1 cells (gift from Bert Vogelstein; Addgene, #16399). Successful incorporation of pShuttle-CMV construct into AdEasier-1 cells confirmed via digestion with PacI (ThermoFisher) ...
-
bioRxiv - Physiology 2019Quote: ... pLKO.1 scrambled shRNA or Sirt4 shRNA was transfected in HEK293 T cells with packaging plasmids pMD2.G (Addgene plasmid # 12259) and psPAX2 (Addgene plasmid # 12260) ...
-
bioRxiv - Developmental Biology 2019Quote: ... using AscI and NotI-containing primers and cloned the fragment into the vector p-attB-min.hsp70P-FRT-STOP#1-FRT-DamMyc[open] (Addgene plasmid #71809). Transgenic lines were generated by Genetivision Inc ...
-
bioRxiv - Cell Biology 2019Quote: ... non-targeting (5’-CCTAAGGTTAAGTCGCCCTCG-3’) and DDRGK1-targeting (5’-GGCTCTGCTAGTCGGCTTTAT-3’) shRNAs were cloned into pLKO.1 puro construct (Addgene #8453) according to protocol described in Addgene (https://www.addgene.org/tools/protocols/plko/?gclid=Cj0KCQiAm5viBRD4ARIsADGUT25ZCGNPeQSFvLqSwvg2tHDkCc9zOZsLdaUffZzNTRYzI_YOlKFVQdUaAqbfEALw_wcB)
-
bioRxiv - Cell Biology 2020Quote: Knockdown of TPM1 was performed using the pLKO.1 plasmid lentiviral backbone (a kind gift from Bob Weinberg, Addgene plasmid #8453) either encoding an shRNA with sequence complementary to TPM1 (shTPM1 ...
-
bioRxiv - Bioengineering 2021Quote: ... The nCas9(D10A) was generated by the PCR method using previously optimized Cas9 as a template (Level 1 hCas9 module, Addgene #49771). Desired sgRNA sequence was PCR amplified using plasmid pICH86966::AtU6p::sgRNA_PDS (Addgene #46966 ...