Labshake search
Citations for Addgene :
2201 - 2250 of 2564 citations for 5 Oxo 5 3 oxo 3 4 dihydro 2H quinoxalin 1 yl pentanoic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... a mixture of flexed AAV GFP (pAAV-FLEX-GFP-Virus, titer ≥ 1×10¹³ vg/mL, Addgene 28304-AAV PHPeB) and CamKII-Cre (pENN.AAV.CamKII 0.4.Cre.SV40 ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 μl and 500 nl of AAV9-hSyn-GRAB-rDA1m (2 x 10^13 vg/ml; Addgene, 140556-AAV9) were injected into the dorsal striatum (AP 0.5 mm ...
-
bioRxiv - Biophysics 2023Quote: ... pLenti CMV rtTA3 Hygro (w785-1) was a gift from Eric Campeau (Addgene plasmid #26730; http://n2t.net/addgene:26730; RRID: Addgene_26730). pLenti CMV rtTA3 Hygro is called rtTA3 in the next sections.
-
bioRxiv - Cancer Biology 2023Quote: ... HEK 293T cells were transfected with either sulfatase 1 or sulfatase 2 expression plasmids or empty vector control derived from pcDNA3.1 (RRID: Addgene_79663) using Lipofectamine 3000 (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... the sgRNA (see table 1) was cloned in to pX458 (Addgene plasmid no 48138(Ran, Hsu et al. 2013)) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Single guide-RNA plasmids were generated by cloning oligonucleotides to the target site (see table 1) into pX335 (Addgene plasmid no ...
-
bioRxiv - Cancer Biology 2023Quote: ... and WDR6 (N-6xHis) coding sequences were codon-optimized for e.coli bacteria and cloned separately into petDuet-1 (purchased from Addgene) using the NcoI site downstream of the first T7 promoter ...
-
bioRxiv - Neuroscience 2023Quote: We designed the syt-jGCaMP8s construct by linking the Drosophila synaptotagmin-1 coding sequences and jGCaMP8s (Addgene Plasmid #162380)69 using a GSGSGS linker ...
-
bioRxiv - Immunology 2023Quote: ... a 4-1BB costimulatory domain and the CAR construct utilized for animals R.301-304 additionally expressed EGFRt.23 CARs were encoded by an xHIV plasmid which was co-transfected with an HIV-1 Rev/Tat and VSV-G envelope plasmid (RRID:Addgene_138479) for lentiviral production as previously described.23
-
bioRxiv - Neuroscience 2024Quote: ... we injected 0.3 μL AAVs encoding ChR2(H134R)-eYFP (titer = 1 x 1012 GC/ml, Addgene# 26973, RRID: Addgene_127090) into the layer 5 of medial prefrontal cortex (mPFC ...
-
bioRxiv - Cell Biology 2024Quote: shRNA coding sequences were cloned and inserted into 3rd generation transfer plasmid pLKO.1-TRC cloning vector (Addgene #10878) following the Addgene protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... A 10-μl Hamilton syringe was used to infuse 1 μl of AAV1/Syn-GCaMP6f-WPRESV40 (titer 4.65 × 1013 GC per ml, via Addgene) into the parabrachial nucleus (−5.3 mm anteroposterior ...
-
bioRxiv - Cancer Biology 2024Quote: ... and MHH-ES-1 were transduced with lentiviral Tet-pLKO-puro all-in-one vector system (plasmid #21915, Addgene) containing a puromycin-resistance cassette ...
-
bioRxiv - Neuroscience 2024Quote: ... we injected 0.3 μL AAVs encoding ChR2(H134R)-eYFP (titer = 1 x 1012 GC/ml, Addgene# 26973, RRID: Addgene_127090) into the layer 5 of medial prefrontal cortex (mPFC ...
-
bioRxiv - Biochemistry 2024Quote: The plasmid encoding full-length human dynein-1 was graciously provided by the Andrew Carter Lab (Addgene plasmid 11903). This plasmid featured the dynein-1 heavy chain fused to an N-terminus for the His-ZZ-SNAPf tag ...
-
bioRxiv - Biochemistry 2024Quote: ... isoform 1) was amplified from K562 cDNA and inserted into insect cell expression vector 438-B (Addgene plasmid: 55219) (N-terminal 6x His (His6 ...
-
bioRxiv - Cell Biology 2024Quote: ... the following cDNA sequences were cloned into pLKO.1 which was a gift from David Root (Addgene plasmid # 10878). by Genscript Corporation:
-
bioRxiv - Molecular Biology 2024Quote: ... LOX-1 tagged with V5-6×His at the C-terminus (V5-LOX-1) was subcloned into pmScarlet_C1 (plasmid #85042; Addgene) (mScarlet-LOX-1) ...
-
bioRxiv - Cancer Biology 2021Quote: The lentiviral constructs encoding mKO2-SLBP(18-126) and Clover-Geminin(1-110) were a gift from Michael Lin (Addgene plasmid # 83915 ...
-
bioRxiv - Cell Biology 2020Quote: ... Nsp1-NT (1-127 aa) and Nsp1-CT (128-180 aa) were amplified from pDONR207 SARS-CoV-2 NSP1 (Addgene) by PCR and then cloned into pDB-His-MBP or BacMam pCMV-Dest plasmid ...
-
bioRxiv - Cell Biology 2020Quote: ... and further subcloned into a CMV driven vector (pLenti CMV V5-LUC Blast (w567-1) was a gift from Eric Campeau (Addgene plasmid #21474 ...
-
bioRxiv - Cell Biology 2020Quote: Pairs of CRISPR guide RNA oligos (mouse Chmp5 single guide RNAs [sgRNAs] targeting GGCTCCGCCACCTAGCTTGA and GTTTCGCTTTTCCGAAGAAT on exon 1 respectively) were annealed and cloned into the BsmBI sites of lentiCRISPR V2-puro vector (plasmid 52961, Addgene). CRISPR lentiviral plasmids and lentiviral packaging plasmids (pMDLg/pRRE ...
-
bioRxiv - Immunology 2021Quote: ... a human RNH1-full coding sequence (ORIGEN RC 200082) insert was cloned into the entry vector pENTR4-GFP-C1 (W392-1, Addgene) and then recombined into the destination vector pLenti CMV Blast DEST (706-1 ...
-
bioRxiv - Immunology 2021Quote: RNH1-KO THP1 cells were infected with lentiviruses expressing RNH1 (pLenti CMV Blast GFP-RNH1) or the empty vector pLentiCMV-GFP-Blast (659-1, Addgene) as previously described (Papin et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... to co-transfect pBABE-puro or pBABE-puro.SLX4IP.3xFLAG with pCMV-VSV-G (at a ratio of 6:1, Addgene#8454) into GP2-293 cells (Clontech) ...
-
bioRxiv - Microbiology 2019Quote: ... 2.18 μg of env-defective HIV-1 provirus containing GFP reporter was cotransfected with 0.31 μg pMD2.G VSV G plasmid (Addgene #12259). Simian immunodeficiency virus (SIV)−VLPs containing Vpx were produced by the transfection of 2.18 μg pSIV−Δpsi/Δenv/ΔVif/ΔVpr (Addgene #132928 ...
-
bioRxiv - Bioengineering 2022Quote: ... sgRNA cassette) were PCR-amplified and recloned into 2 lentiviral plasmids (pLKO.1 neo, Addgene #13425; pLJM-EGFP, Addgene #19319) and ...
-
bioRxiv - Immunology 2019Quote: ... pMul1-FLAG and pAsc-Myc were subcloned into pLenti X2 Hygro DEST (a gift from Eric Campeau and Paul Kaufman, w17-1, #17295, Addgene) and transfected into HEK293T cells together with the helper plasmid (psPAX2 ...
-
bioRxiv - Microbiology 2019Quote: ... and cloned into EcoRV-cut pLenti CMV Puro DEST (w118-1) (gift from Eric Campeau & Paul Kaufman; Addgene plasmid # 17452) using NEBuilder® HiFi DNA Assembly Master Mix (New England BioLabs) ...
-
bioRxiv - Neuroscience 2020Quote: ... injections of rAAV2-retro-Cre (produced by Salk Vector Core or Vigene, 2×1012 to 1×1013 viral genomes/ml, produced with capsid from Addgene plasmid #81070 packaging pAAV-EF1a-Cre from Addgene plasmid #55636 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... to specifically target TP53 translation stop site and it was cloned into pX330-U6-Chimeric_BB-CBh-hSpCas9-hGem (1/110) (Addgene #71707) according to the protocol of Ran et al.51 ...
-
bioRxiv - Neuroscience 2020Quote: ... Whole-cell patch-clamp recordings were also performed for functional evaluation of Cl− microdomains (Figure 1) on organotypic slices of DLX-Cre mice which were transfected on the day of slicing with tdTomato virus (Addgene-AAV9-CAG-FLEX-tdTomato ...
-
bioRxiv - Biochemistry 2020Quote: ... H-HCF-1) and full length human THAP11 cDNA with carboxy-terminal FLAG tag (Plasmid #28020; F-THAP11) were obtained from Addgene. Vectors containing full length human THAP1 cDNA with carboxy-terminal 1X FLAG tag (THAP1-F ...
-
bioRxiv - Biophysics 2020Quote: ... as per the manufacturer’s instructions into pLenti CMV Hygro DEST (W117-1, a gift from Dr. Eric Campeau & Dr. Paul Kaufman, Addgene #17454) to create the final vector which was sequence verified by Sanger sequencing (Australian Genome Research Facility) ...
-
bioRxiv - Cancer Biology 2020Quote: ... we designed single guide RNAs specifically targeting exon 1 of the mouse Bmal1 gene and subcloned it into the PX459 vector (Addgene) to obtain the PX459-Bmal1 plasmid ...
-
bioRxiv - Cancer Biology 2019Quote: ... was prepared by introducing four silent mutations into the sequence targeted by shNRF2 #1 in pEN_TT 3xFLAG-NRF2 (Addgene #136527). Site-directed mutagenesis was performed with the QuikChange II XL kit (Agilent).
-
bioRxiv - Cell Biology 2021Quote: ... NANOG and PRDM14 (see Table 1) were cloned into pLentiCRISPR V2 vectors with puro (SOX2, NANOG) or hygromycin B (PRDM14) resistance (Addgene plasmids #52961 and #98291 respectively ...
-
bioRxiv - Cell Biology 2021Quote: ... gonads of young adult BOX428 animals were microinjected with 30 ng/μl Pelt-2::αGFP-NB::ZIF-1 and 2.5 ng/μl Pmyo-2::GFP (#Addgene 26347) as a co-injection marker ...
-
bioRxiv - Cell Biology 2021Quote: ... and pLKO.1 puro-based plasmid harboring the designed shRNA (pCMV-VSV-G and pLKO.1 puro were a gift from Bob Weinberg, Addgene plasmid #8454 ...
-
bioRxiv - Neuroscience 2020Quote: PV-Cre and SST-Cre slices were transfected in three different configurations: 1) 2.2 μL of ChETA (pAAV9-Ef1a-DIO-ChETA-EYFP Addgene#: 26968) and 1 μL of LSL-tdTomato (Addgene# ...
-
bioRxiv - Microbiology 2021Quote: Individual sgRNAs (sgLRRC15 #1: GACATGCAGGCACTGCACTG; sgLRRC15 #2: AGTGTCAGCCCGGGACATGC; sgACE2: GTTACATATCTGTCCTCTCC) targeting the candidate genes were cloned into linearized pXPR_502 (Addgene, #96923) for CRISPR activation ...
-
bioRxiv - Molecular Biology 2020Quote: A pET28a vector with sub-cloned cDNA of Hsp53-(1-73) (72R) and the N-terminal His-tag was procured from Addgene, (plasmid #62082) ...
-
bioRxiv - Neuroscience 2020Quote: ... to label hyaluronic acid-based ECM we designed AAV expression vector carrying link protein hyaluronan and proteoglycan link protein 1 (HAPLN1, Gene ID: 12950) fused with mScarlet subcloned from the plasmid pCytERM_mScarlet_N1 (Addgene plasmid # 85066). Clones were verified by sequencing analysis and used for the production of adeno-associated particles as described previously (Mitlöhner et al ...
-
bioRxiv - Bioengineering 2020Quote: ... 400,000 HEK cells were seeded in 6-well plates and the next day transfected with 1 μg psPAX2 (Addgene #12260), 3 μg pCMV-VSV.G (Addgene ...
-
bioRxiv - Cell Biology 2020Quote: Huwe1 stable knockdown: The same targeting sequences as for siRNA studies were cloned to pLKO.1 puro plasmid (Addgene 8453). As control ...
-
bioRxiv - Cancer Biology 2021Quote: ... Luciferase was introduced into pediatric brain tumor cell lines using lentiviral plasmids: pLenti CMV Puro LUC (w168-1) was a gift from Eric Campeau & Paul Kaufman(45) (Addgene plasmid # 17477 ...
-
bioRxiv - Cell Biology 2022Quote: ... RPE-1 TUB-mRFP cells were generated in our lab by transduction with lentiviral vectors containing tubulin m-RFP (Addgene). HEK293T cells at a 50-70% confluence were co-transfected with lentiviral packaging vectors (16.6 μg of Pax2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were transfected with a 6:1 ratio of a firefly luciferase reporter plasmid driven by a pGL3-RARE-responsive promoter (Addgene) and a Renilla luciferase reporter plasmid driven by a constitutive CMV promoter (Promega) ...
-
bioRxiv - Biochemistry 2022Quote: ... full-length FUS with an N-terminal histidine tag and maltose-binding protein fusion (pTHMT FUS 1-526, AddGene #98651), and FUS RGG3 with N-terminal histidine tag and MBP fusion (pTHMT FUS RGG3 (453-507) ...
-
bioRxiv - Cell Biology 2022Quote: ... organoid fragments were washed and resuspended in Opti-MEM supplemented with Y-27632 (10 µM) and 10µg of pSPgRNA plasmid together with the frame selector plasmid pCAS9-mCherry-Frame +1 (Addgene #66940) and the mNEON targeting plasmid (a kind gift from V ...