Labshake search
Citations for Addgene :
2001 - 2050 of 2656 citations for 4' Trifluoromethoxy 5 trifluoromethyl 1 1' biphenyl 3 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... 8 µg psPAX2 packaging plasmid DNA and 1 µg pMD2.G envelope plasmid DNA (both gifts from Didier Trono, Addgene plasmid no ...
-
bioRxiv - Neuroscience 2023Quote: ... we bilaterally (2-2.5 mm lateral and 3.5-4.0 mm posterior from Bregma) injected 1 uL of the conditional GtACR2 virus (AAV5-hSyn1-SIO-stGtACR2-FusionRed, Addgene #105677), or 1uL saline injection for controls ...
-
bioRxiv - Cancer Biology 2023Quote: ... shRNA 2 (shYAP1 #2) or scramble shRNA (shNC) were inserted into pLKO.1-TRC Cloning Vector (Addgene, 10878, RRID: Addgene_10878) following the manufacturer’s protocol and sequenced ...
-
bioRxiv - Molecular Biology 2023Quote: ... Sequences encoding Ifi205 ORF and Ifi205K364ER299E ORF were amplified by PCR then subcloned between the BamHI and EcoRI restriction sites of pGEX-6P-1(Addgene). Ifi205 proteins were expressed as GST-Ifi205-FLAG-fusions in the E ...
-
bioRxiv - Neuroscience 2023Quote: ... two gRNAs designed to target exon 1 of ZNF91 [24] were cloned and inserted into pX330-SpCas9-HF1 (Addgene #108301). In addition to the gRNAs ...
-
bioRxiv - Neuroscience 2023Quote: ... of adeno-associated viruses encoding the genetically-encoded calcium indicator GCaMP6s and mRuby2 as a structural marker under the control of the synapsin 1 promoter (pAAV-hSyn1-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA, cat. no. 50942-AAV1, Addgene) and slowly lowered to ∼350 µm below the surface of the exposed brain with an HO-10 hydraulic micromanipulator (Narishige) ...
-
bioRxiv - Cancer Biology 2023Quote: ... shRNA 2 (shYAP1 #2) or scramble shRNA (shNC) were inserted into pLKO.1-TRC Cloning Vector (Addgene, 10878, RRID: Addgene_10878) following the manufacturer’s protocol and sequenced ...
-
bioRxiv - Cancer Biology 2023Quote: ... For each microgram crude eccDNA we spiked in 1 ng pUC1932 (was a gift from Joachim Messing, Addgene plasmid # 50005; RRID: Addgene_50005) and 1 ng egfr fragment to generate crude circular DNA mixture.
-
bioRxiv - Cancer Biology 2023Quote: ... we designed single guide RNAs to target the exon 1 of the human Per2 gene and subcloned it into the PX459 vector (Addgene) to obtain the PX459-Per2 plasmid ...
-
bioRxiv - Developmental Biology 2023Quote: ... expressing a dominant negative variant of the rol-6 gene and an empty vector pSK (up to 200 ng μl-1 of DNA) (Addgene) using standard methods (42) ...
-
bioRxiv - Cell Biology 2023Quote: ... We generated monoclonal U2OS cell lines expressing the following fluorescent plasmids: 1) ptfLC3B was a gift from Tamotsu Yoshimori (Addgene plasmid #21074 ...
-
bioRxiv - Neuroscience 2024Quote: ... Each eye was intravitreally injected with 1 μL of AAV2-hSyn-DIO-mCherry (∼8 x 1012 GC/mL, cat. #: 50459-AAV2, Addgene) using a custom Hamilton syringe (Borghuis Instruments ...
-
bioRxiv - Neuroscience 2024Quote: ... Each eye was intravitreally injected with 1 μL of AAV2-hSyn-DIO-hM3Gq-mCherry (∼8 x 1011 GC/mL, Addgene) using a custom Hamilton syringe (Borghuis Instruments ...
-
bioRxiv - Cancer Biology 2024Quote: ... and annealed and ligated in the pLKO.1 Hygro linearized backbone (a gift from Bob Weinberg, plasmid #24150 on Addgene). Stbl3 bacteria were heat-shocked to uptake ligated plasmid ...
-
bioRxiv - Cancer Biology 2024Quote: ... to target NCL translation start site and the targeting sequence was cloned into pX330-U6-Chimeric_BB-CBh-hSpCas9-hGem (1/110) (Addgene#71707)103 according to standard protocols104 ...
-
bioRxiv - Cell Biology 2024Quote: ... Short hairpin RNAs (shRNAs) targeting WSB2 or BCL-2 family proteins were subcloned into the pLKO.1 puro vector (Addgene) for gene KD ...
-
bioRxiv - Neuroscience 2024Quote: ... Oertner) or AAV2/1-EF1a-DIO-iChloC-2A-dsRed (5x1013 GC/ml; Addgene plasmid #70762, a gift from T. Margrie). For calcium imaging experiments ...
-
bioRxiv - Plant Biology 2024Quote: ... The CDS of the prey protein (CLPS1) was cloned and inserted into the pET His6 MBP TEV LIC cloning vector (1 M) (#29656, Addgene) cloning vector to generate fusion constructs with an MBP tag ...
-
bioRxiv - Molecular Biology 2024Quote: ... A guide RNA sequence was selected to target exon 1 of MTU1 and cloned into LentiCRISPR v2 (a gift from Feng Zhang, Addgene plasmid # 52961 ...
-
bioRxiv - Biochemistry 2024Quote: ... A recombinant expression construct encoding the DOT1L catalytic domain (Uniprot Q8TEK3; residues 1-420) was purchased from AddGene (AddGene #36196). A recombinant expression construct encoding the Haspin kinase domain (GSG2 ...
-
bioRxiv - Neuroscience 2024Quote: ... Rats were placed under isoflurane anesthesia and received unilateral or bilateral infusions of AAV1-Syn-Flex-GCaMP6f-WPRE-SV40 (1×1013vg/mL, Addgene) to allow for Cre-dependent expression of GCaMP in the VTA (AP -5.5 mm ...
-
bioRxiv - Neuroscience 2024Quote: ... At P1-P2 pups were anaesthetized with Iso-fluorane and intra-cortically injected with 1 ul of a viral solution containing (AAV-EF1A-Gephyrin.FingR-GFP-CCR5TC – Addgene#125692 and AAV-CAG-tdTomato - Addgene# 59462) into layers 2/3 using a Drummond Nanojet microinjector according to the manufacturer’s protocol.
-
bioRxiv - Neuroscience 2024Quote: ... with 1 µl pAAV-mDlx-GFP-Fishell-1 (83900-AAV1), kindly shared by Dr. Gordon Fishell (Dimidschstein, Chen et al. 2016) and purchased from Addgene.
-
bioRxiv - Cell Biology 2024Quote: WT (M63.1: pMG-INV 36: iCas9.302) abl pre-B cells with chromosomally integrated pMG-INV reporter and pCW-Cas9 (Addgene #50661) were described previously (29) ...
-
bioRxiv - Developmental Biology 2024Quote: Approximately 1 × 106 trisomic proband iPS cells were transiently co-transfected with a plasmid that expressed a gRNA (Addgene: 229941) specific to the chromosome 8 centromere region and the mCherry-KNL1Mut-dCas9 plasmid ...
-
bioRxiv - Developmental Biology 2024Quote: ... gRNAs 1 and 2 (Supplemental Table 2) were cloned into the pSpCas9n(BB)-2A-Puro (PX462) V2.0 plasmid (Addgene 62987) as described previously70 ...
-
bioRxiv - Cancer Biology 2024Quote: ... gRNA was cloned into the Bbs1 restriction site of the pX330-U6-Chimeric_BB-CBh-hSpCAas9-hGem (1/110) vector (Addgene #71707) before transformation into NEB® 5-alpha Competent E ...
-
bioRxiv - Cell Biology 2024Quote: ... 100,000 HeLa M cells were plated per well in a 6-well plate and transfected the following day at a ratio of 1:15 with the pEGFP-Puro plasmid (45561; Addgene) and gRNA-containing plasmid (pX330A-1×2) ...
-
bioRxiv - Cell Biology 2024Quote: ... of ArfGAP1 was amplified from pGEX-6P-1-hs-ALPS1-ALPS2-mCherry (a gift from Philipp Niethammer (Addgene plasmid # 187114; RRID: Addgene_187114); (Shen et al. ...
-
bioRxiv - Cell Biology 2024Quote: PS-DKO cells were transfected with the truncated mature form of SREBP2 (2xFLAG-SREBP2, aa 1-482, Addgene plasmid #26807), which is targeted to the nucleus where it activates cholesterol biosynthesis gene programs ...
-
bioRxiv - Cancer Biology 2024Quote: 3x105 parental and clonally derived Cas9-expressing OCI-AML2 or PANC-1 cells were infected with pXPR_011 (Addgene Plasmid #59702) virus as described above ...
-
bioRxiv - Cancer Biology 2024Quote: Lentivirus was produced by cotransfection of a lentiviral vector (pLJM1, pLVX, pLKO.1) and the packaging plasmids psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Cell Biology 2020Quote: ... Injection mixes were prepared in MilliQ H O and contained 50 ng/ml Peft-3::cas9 (Addgene ID #46168) (Friedland et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... The injection mix was prepared in MilliQ H2O and contained 50 ng/μL Peft-3::cas9 (Addgene ID #46168) (Friedland et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... Two guide RNAs (cgttcatatcctcgcgagta and cagccgagaccacgactacc) designed to target exon 3 (14-bp apart) were cloned into pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: pUltra-U6-crRNAs-U6-tracr was constructed in a 3-part Gibson assembly using PacI linearized pUltra (Addgene #24129)54 backbone ...
-
bioRxiv - Cell Biology 2021Quote: ... with that of mEos3.2 (Zhang et al., 2012) (generated by making 3 point mutations, I102N, H158E, and Y189A in the Addgene mEos2 plasmid #20341 [http://n2t.net/addgene:20341 ...
-
bioRxiv - Cell Biology 2021Quote: ... The cDNA encoding mEos3.2-paxillin was generated by replacing the cDNA encoding mGFP in the mGFP-paxillin plasmid with that encoding mEos3.2 (Zhang et al., 2012) (generated by making 3 point mutations, I102N, H158E, and Y189A in the Addgene mEos2 plasmid #20341 [http://n2t.net/addgene:20341 ...
-
bioRxiv - Cancer Biology 2021Quote: ... PTEN or non-targeting-control (see Table 3) were cloned into pLKV2-U6gRNA5(BbsI)-PGKpuro2ABFP-W (Addgene ID:67974) and Cas9 expressing cell lines were transduced and selected with puromycin (Gibco ...
-
bioRxiv - Molecular Biology 2020Quote: ... by PCR and products were cloned into NheI and EcoRV restriction sites (Table 3: marked with blue) of pcDNA3.1-hygro vector (Addgene, kindly provided by Mark Richards-Bayliss group ...
-
bioRxiv - Genomics 2021Quote: ... we performed 80 co-transfections of HeK293T virus packaging cells (at approximatelly 60-70% confluence on 10 cm dishes) with 3 μg of the pDECKO_mCherry plasmid library and 2.25 μg of the packaging plasmid pVsVg (Addgene 8484) and 750 ng of psPAX2 (Addgene 12260 ...
-
bioRxiv - Immunology 2022Quote: ... and mSGK3 exon 3 (TTCAAGACATTAAATGCAG) were designed using the online tool CHOPCHOP (http://chopchop.cbu.uib.no/) and cloned into TLCV2 (Addgene plasmid # 87360,) as described previously5455 ...
-
bioRxiv - Plant Biology 2022Quote: The longer and shorter transporter 3′ UTRs were cloned into the dual luciferase construct pGreen_dualluc_3′UTR_sensor at EcoRI sites (Addgene, Cat: 55206). The longer 3′ UTRs without AU-rich elements were amplified using flanking PCR methods ...
-
bioRxiv - Cancer Biology 2022Quote: ... 4T1 and EMT6.5 cancer cells were transfected with the mammalian expression lentiviral vector pLKO.3 Thy1.1 (Addgene plasmid #14749) containing the surface protein Thy1.1 as a reporter protein ...
-
bioRxiv - Cell Biology 2022Quote: ... the full-length dFz2 ORF was amplified and then mScarlet-I was fused to its 3’ end (Addgene #85044). The dFz2-Scarlet fusiomn was then cloned into the UASp vector ...
-
bioRxiv - Molecular Biology 2024Quote: ... pCS2-nCas9n-nanos 3’UTR was a gift from Antonio Giraldez (Addgene plasmid # 62542; http://n2t.net/addgene:62542; RRID: Addgene_62542). 250 ng/μl of Cas9 mRNA and 50 ng/μl of gRNA(s ...
-
bioRxiv - Cell Biology 2024Quote: ... anti-ALFA nanobody fragment was amplified using primers s15 and s16 (Table 3) from its expression vector (Addgene #189755). A pET24a-VHH-std vector (Addgene #109417 ...
-
bioRxiv - Cell Biology 2024Quote: ... 3.7 μg pLenti6.3-HA-NL-tetraspanin plasmids or pLenti6.3-CD63-pHluorin plasmid were co-transfected with 0.9 μg pREV (Addgene, 12253) and 1.8 μg pRRE (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: Wild-type and Flailer primary neuronal cultures were infected at 3 DIV with AAV coding for GCaMP6s (Addgene #51086) and FL1 or control AAVs ...
-
bioRxiv - Cell Biology 2022Quote: ... a lenti-viral backbone containing a UCOE-EF-1α promoter and a 3’ WPRE element was used (Addgene #135448), which was a kind gift of Martin Kampmann and Jonathan Weissman ...