Labshake search
Citations for Addgene :
151 - 200 of 980 citations for hsa mir 940 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... its shorter isoform has been amplified from IMR90 cDNA with specific primers and cloned in pcDNA3.1(+) vector (purchased from Addgene). For overexpression studies ...
-
bioRxiv - Cell Biology 2024Quote: ... anti-ALFA nanobody fragment was amplified using primers s15 and s16 (Table 3) from its expression vector (Addgene #189755). A pET24a-VHH-std vector (Addgene #109417 ...
-
bioRxiv - Cell Biology 2021Quote: ... Rtn4b-HaloTag was generated by inserting PCR-amplified Rtn4b from Rtn4b-GFP and PCR-amplified HaloTag from pSEMS-Tom20-HaloTag (Addgene plasmid #111135 ...
-
bioRxiv - Molecular Biology 2022Quote: The Dux promoter was amplified by PCR with PCR mix (Yeasen, 10149ES03) and then cloned into pGL4.10[luc2] (Addgene, E6651) vector ...
-
bioRxiv - Microbiology 2022Quote: ... PCR fragments amplified from pFLAG-attP (Addgene, #110095) with primers Apr fw/Apr rv and from pSEVA524 with primers tetA fw/tetA rv,25 respectively ...
-
bioRxiv - Genetics 2022Quote: ... The TDH3 promoter was PCR-amplified from Addgene plasmid #67639 (a gift from John Wyrick) ...
-
bioRxiv - Genetics 2022Quote: ... We PCR amplified the NatMX cassette from Addgene plasmid #35121 using primers with homology to the 5’ upstream and 3’ downstream sequences of the targeted gene ...
-
bioRxiv - Biochemistry 2021Quote: ... The PCR product and pCS2-FLAG (AddGene 16331) were digested with EcoRI and XhoI and ligated with T4 DNA Ligase ...
-
bioRxiv - Cell Biology 2022Quote: ... A PCR product of ColX (from Addgene #110726) and a synthetic gene containing PAUF (Integrated DNA Technologies ...
-
bioRxiv - Molecular Biology 2020Quote: ... The PCR products were cloned into pRAV23 (Addgene) using EcoRI and HindIII restriction sites and transformed into Top10 cells ...
-
bioRxiv - Cell Biology 2020Quote: ... a PCR product of myc-BirA* (35700; Addgene) was ligated into XhoI and SpeI cleaved pCAG-mNCad-HA ...
-
bioRxiv - Microbiology 2022Quote: ... which was PCR-amplified from pSFGFP-N1 (Addgene) [55].
-
bioRxiv - Cell Biology 2022Quote: ... The iRFP ORF was PCR amplified from Addgene plasmid #45457.
-
bioRxiv - Cancer Biology 2023Quote: ... HOXB13 was PCR amplified from pLX302_HOXB13 (Addgene #70089), digested with SalI/XbaI and ligated into linearized pENTR1A (Addgene #17398) ...
-
bioRxiv - Neuroscience 2023Quote: ... Gamillus obtained by PCR reaction from (Addgene #124837) was inserted in place of SEP with a use of NEBuilder HiFi DNA Assembly ...
-
bioRxiv - Developmental Biology 2024Quote: ... was PCR amplified from pJW2171 (Addgene plasmid #163095) and concentrated using a PCR purification kit (Qiagen) ...
-
bioRxiv - Genomics 2020Quote: ... and a revers primer (5′-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-GTGTCTCAAGATCTAGTTACGCCAAGC-3′) were used to amplify 222 bp fragments from CROPseq-Guide-Puro plasmids (#86708, Addgene) which have been inserted with different gRNA sequences ...
-
bioRxiv - Genomics 2019Quote: ... PCR products corresponding to each crRNA were amplified with U6 forward primer and corresponding antisense oligos (as listed in Supplemental Table S1) from the pX330 plasmid (Cat. 42230, Addgene). After digestion with DpnI (Cat ...
-
bioRxiv - Molecular Biology 2019Quote: ... gRNAs were obtained by annealing and cloning complementary primers into vector pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A) containing humanized S.pyogenes Cas9n(D10A) nickase (Addgene, cat. # 42335). Primers were designed to target the exon 2 of C6orf203 gene using E-CRISP double nickase platform (http://www.e-crisp.org/E-CRISP/ ...
-
bioRxiv - Bioengineering 2019Quote: ... and a 677-bp p10 3’ untranslated region (UTR) amplified with primers 984.4A and 984.4B from vector pJFRC81-10XUAS-IVS-Syn21-GFP-p10 (Addgene plasmid #36432). The anti-DENV scFv was then subcloned into the final vector from a gene-synthesized plasmid (GenScript ...
-
bioRxiv - Bioengineering 2021Quote: ... the U6.3-gRNATraB fragment was PCR amplified from the sgRNATra-B plasmid using primers 2XgRNA-5F and 2XgRNA-6R and was cloned into the sgRNAβTub plasmid (Addgene #112691). To build the TI-pgSITsxl,βTub,Hsp-Cas9 and TI-pgSITTraB,βTub,Hsp-Cas9 constructs (Supplementary Fig ...
-
bioRxiv - Neuroscience 2020Quote: ... which was cloned using forward 5’TTGACTGGCGTCATTCGGGA3’ and reverse 5’TCAGGAAGATCTGGGCAAAGAG3’ primers and expressed through the pInducer20 lentiviral vector (Addgene). Western blots were performed using actin as loading control ...
-
bioRxiv - Molecular Biology 2022Quote: ... dsDNA repair templates were amplified using primers with 5’ SP9 modifications (IDT) from the pJRK86 plasmid (AID*::GFP, Addgene #173743) and mIAA7 repair template plasmids in table 1 ...
-
bioRxiv - Genetics 2022Quote: ... with 5’ KpnI and 3’ EcoRI sites (primers LC127 and 128) into the corresponding restriction digestion sites of pLP9 (Addgene plasmid #1497 ...
-
bioRxiv - Molecular Biology 2019Quote: ... PCR fragments containing tdTomato-SpHis5 and homologies to YFP were amplified with primers F4 and R4 from the plasmid pfa6a-link-tdTomato-SpHis5 (Addgene), and transformed into JA0219 and JA0220 ...
-
bioRxiv - Genomics 2020Quote: ... was amplified from the pBS-U6-CMV-EGFP plasmid [65] with primers complementary to EGFP and NheI restriction sites (see Supplementary Table S3) and inserted into NheI digested pcDNA3.1(-)(Addgene, V79520). Ligation was performed using T4 DNA ligase according to manufacturer instructions ...
-
bioRxiv - Microbiology 2020Quote: ... The sfgfp gene was PCR-amplified with primers 35 and 36 from plasmid pHR-scFv-GCN4-sfGFP-GB1-NLS-dwPRE (gift from Ron Vale; Addgene plasmid # 60906 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The GFP fragment was amplified and C-terminally Flag-tagged using primers GFP_IndOE_F & R and the construct pT2-CAG-fGFP (Addgene plasmid #108714) as template ...
-
bioRxiv - Molecular Biology 2021Quote: The knockdown plasmids for REST/NRSF and for the control GFP were constructed by ligating annealed primer pairs into the pLKO.1 vector (Addgene) between the EcoRI and AgeI sites ...
-
bioRxiv - Plant Biology 2022Quote: ... a 4.5 kb genomic region upstream of the first annotated ATG in the ATM1 gene was amplified using gene specific primers and ligated into pENTR5’ (Plasmid 27320; Addgene) to create plasmid pDO#22 (pENTR5’-ATM1pro (4.5kb)) ...
-
bioRxiv - Molecular Biology 2022Quote: SUGP1 constructs were cloned from pHA-SUGP1 using primers (IB0156 5’-atgacgtcccagactacgcagctagcAGTCTCAAGATGGACAACC-3’; IB0157 5’-tgtttagcgttcagcagcgggatagatccgcctgaGTAGTAAGGCCGTCTGG-3’) into pCDNA3_3xHA-miniTurbo-NLS (Addgene #107172) digested with NheI-HF (NEB #R3131).
-
bioRxiv - Physiology 2023Quote: ... sgRNA primers were (Table 2) cloned into BbsI-HF linearized pU6-(BbsI)_CBh-Cas9-T2A-mCherry (Addgene, Plasmid Cat. #64324) or pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene ...
-
bioRxiv - Plant Biology 2023Quote: The full-length or 3TPR-truncated cDNA sequence of SPY was amplified from Arabidopsis cDNA with appropriate primers (listed in Supplemental Table 1) and cloned into the pET28sumo vector (Addgene?), which adds a 6xHis-SUMO tag to the N-terminus of the protein of interest ...
-
bioRxiv - Developmental Biology 2023Quote: ... were PCR-amplified from N2 genomic DNA with primers harbouring overhangs for Gibson assembly with the pDD282 vector (Dickinson et al., 2013) (a gift from Bob Goldstein (Addgene plasmid # 66823 ...
-
bioRxiv - Cell Biology 2024Quote: ... the primers 5’-CACCGCATCGCTCCTGCGTCCGCCA-3’ and 5’-AAACTGGCGGACGCAGGAGCGATGC-3’ were annealed and subcloned into px458-pSpCas9(BB)-2A-GFP (Addgene) using the BpiI restriction site to generate a guide RNA ...
-
bioRxiv - Genetics 2021Quote: ... DNA templates for PCR-IVT were produced using overlapping oligonucleotides in a high-fidelity PCR reaction47 or using a plasmid template (Addgene #4223048) and appropriate primers46 ...
-
bioRxiv - Molecular Biology 2021Quote: ... This plasmid was used as a template for PCR and 2500ng of purified HDR template PCR product combined with 1500ng of guide RNA expression plasmid (Addgene 49330) containing the guide RNA listed in Table S4 were co-transfected into OSCs ...
-
bioRxiv - Genomics 2023Quote: ... We further replaced the Cas9 cassette with an nCas9/M-MLV-RT cassette from the pCMV-PE2 plasmid (Addgene, 132775). The lentiV2-pegRNA and lentiV2-ngRNA plasmids were constructed by replacing the Cas9 and Puromycin sequences in the lentiCRISPR v2 plasmid (Addgene ...
-
bioRxiv - Cell Biology 2019Quote: ... PCR products were ligated into lentiCRISPR v2 (Addgene, 52961) using Gibson Assembly® Master Mix (New England Biolabs ...
-
bioRxiv - Molecular Biology 2019Quote: ... mCherry was PCR amplified from Cas9-mCherry (Addgene #78313) and cloned into the BamHI site ...
-
bioRxiv - Cancer Biology 2020Quote: ... which was PCR-amplified from pEMS1384 (Addgene Plasmid #29304). The pHes5-d2EGFP plasmid was a gift from Ryoichiro Kageyama (Ohtsuka et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... PCR amplified and cloned into lentiCRISPRv2 (Addgene Plasmid #52961) and lentiGUIDE-puro (Addgene Plasmid #52963 ...
-
bioRxiv - Neuroscience 2020Quote: ... we first PCR amplified the OXTR sequence (Addgene, #66467) to contain ClaI restriction enzyme sites at each end ...
-
bioRxiv - Neuroscience 2020Quote: ... the human ACE2 ORF was PCR amplified from Addgene plasmid 1786 and C-terminally fused with the porcine teschovirus-1-derived P2A cleavage sequence (ATNFSLLKQAGDVEENPGP ...
-
bioRxiv - Biophysics 2020Quote: Full length HP1α was amplified by PCR (Addgene 17652), and cloned using InFusion kit into a pHR lentiviral vector under an SFFV promoter and tagged C-terminally with mCherry and sspB ...
-
bioRxiv - Cell Biology 2022Quote: ... mApple and sfCherry2 cDNAs were PCR-amplified from Addgene plasmids #54862 and #83031 ...
-
bioRxiv - Molecular Biology 2022Quote: ... one obtained by PCR on pRPR1_gRNA_handle_RPR1t (Addgene Plasmid #49014) using OFS_2869 and OFS_2870 oligonucleotides ...
-
bioRxiv - Neuroscience 2020Quote: ... Postsynaptic mouse neuroligin-1 was PCR amplified from Addgene #15260 ...
-
bioRxiv - Biochemistry 2021Quote: A PCR product from plasmid pDD282 (Addgene plasmid # 66823) was used as a donor template for insertion of gfp ...
-
bioRxiv - Cancer Biology 2020Quote: ... PCR products were subcloned into the pUC19 plasmid (Addgene) and sequenced.