Labshake search
Citations for Addgene :
151 - 200 of 918 citations for TXNDC12 Human HEK 293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... and the injections of AAV5-hSyn-NES-his-CaMPARI2-WPRE-SV40 (2.5x10^12gc/ml Addgene 200nl measured using a Nano Injector ...
-
bioRxiv - Biophysics 2019Quote: Genetic constructs encoding the inward rectifying potassium channel Kir2.1 and the blue-shifted channelrhodopsin CheRiff were separately cloned into lentiviral expression backbones (FCK-CMV) and then co-expressed in HEK 293T cells along with the lentiviral packaging plasmid PsPAX2 (Addgene) and the envelope plasmid VsVg (Addgene ...
-
bioRxiv - Bioengineering 2020Quote: ... 400,000 HEK cells were seeded in 6-well plates and the next day transfected with 1 μg psPAX2 (Addgene #12260), 3 μg pCMV-VSV.G (Addgene ...
-
bioRxiv - Neuroscience 2022Quote: For HEK-cell expression, mutations were introduced in previously described ACR constructs of GtACR1 (Wietek et al., 2016) (Addgene #85464) and PhobosCA (Wietek et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... we transfected HEK 293T/17 cells with different plasmids together with the packaging plasmids pMD2.G (Gift from Didier Trono (Addgene plasmid #12259 ...
-
bioRxiv - Microbiology 2021Quote: ... HEK 293T cells in 10cm dishes were transfected at 80% confluency with the lentiviral plasmid pLenti-CMV-Puro (Addgene #17452) containing the gene of interest (2 μg) ...
-
Nonsense Mediated RNA Decay Is a Unique Vulnerability of Cancer Cells with SF3B1 and U2AF1 MutationsbioRxiv - Cell Biology 2021Quote: ... HEK 293T cells were transfected with lentiviral vectors and packaging vectors (pCMV-VSVG and psPAX2, Addgene # 8454 and 12260, respectively), using the Mirus TransIT-LT1 transfection reagent ...
-
bioRxiv - Biochemistry 2021Quote: SARS-CoV-2 S-Pseudotyped lentivirus27,43 were produced by co-transfection of HEK-293T cells with plasmids bearing a GFP reporter gene (pLB was a gift from Stephan Kissler, Addgene plasmid #11619 ...
-
bioRxiv - Cancer Biology 2021Quote: Lentiviral constructs were also packaged in HEK-293T cells by transient co-transfection with the packaging constructs psPax2 (Addgene #12260) and pMΔ2.G (Addgene #12259) ...
-
bioRxiv - Physiology 2022Quote: ... 60% confluent monolayers of 293-T cells were transfected with LV shuttle vector pUltra-hot-LT and the packaging plasmids psPAX2 (Addgene, 12260) and pMD2.G (Addgene ...
-
bioRxiv - Biophysics 2022Quote: ... Lentivirus expressing LifeAct-GFP were produced in HEK 293T cells by cotransfecting the lentiviral plasmids pLenti.PGK.LifeAct-GFP.W (a gift from Rusty Lansford, Addgene plasmid #51010; Watertown, MA) with psPAX2 and pMD2 ...
-
bioRxiv - Immunology 2021Quote: TXN1-/- HEK 293T cells were prepared by transient transfection of HEK 293T cells stably expressing Cas9 with sgRNA for TXN1 packaged in lentiGuide-Puro (Addgene, 52963) using the following oligo sequences (5’-ACGTGATATTCCTTGAAGTA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... Lentiviruses were produced by transfecting HEK-293T cells with the transfer lentiCRISPR v2 plasmids and packaging plasmids pLTR-G (Addgene, 17532) and pCD/NL-BH*DDD (Addgene ...
-
bioRxiv - Neuroscience 2020Quote: ... HEK 293T cells (ATCC CRL-11268) were transfected with expression vectors for the ribozyme-flanked viral genome (cSPBN-4GFP (Addgene 52487) or pRVΔG-4tdTomato (Addgene 52500)) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lentivirus constructs were also packaged in HEK-293T cells by transient transfection of the constructs in combination with the packaging constructs psPax2 (Addgene #12260) and pMΔ2.G (Addgene #12259) ...
-
bioRxiv - Immunology 2019Quote: ... These were packaged into a VSV-G pseudotyped lentiviral vector using HEK 293T cells expressing pMD2.G (2 ng, Addgene #12259), pCMV-DR8.2 (5 ng ...
-
bioRxiv - Cancer Biology 2021Quote: ... shRNA gene knockdown or gene overexpression lentiviral vectors were transfected into HEK 293FT cells together with a packaging plasmid (psPAX2; Addgene; #12260) and envelope plasmid (pMD2G ...
-
bioRxiv - Cancer Biology 2023Quote: ... Lentiviruses were produced by triple transfection of HEK-293T cells with the lentiviral transfer vector pLenti6.3/TO/V5-Blasti and the packaging plasmids psPAX2 (Addgene plasmid #12260) and pMD2.G (Addgene plasmid #12259) ...
-
bioRxiv - Cell Biology 2022Quote: ... replication-deficient lentiviruses were produced and titrated as described by co-transfection of the resulting constructs in HEK-293T cells with the HIV-1 packaging plasmid psPAX2 (Addgene #12260) and the plasmid pMD2.G (Addgene #12259 ...
-
bioRxiv - Cell Biology 2023Quote: ... viruses were produced in HEK 293T cells by transfecting the corresponding plasmid o interest as well as with pVSVg (Addgene, #8454) and psPAX2 (Addgene ...
-
bioRxiv - Developmental Biology 2023Quote: ... lentiviral supernatants were generated by transfecting one 10-cm plate of HEK-293T cells at 90% confluency with 3 µg pMD2.G (Addgene #12259), 9 µg psPAX2 (Addgene #12260) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Lentivirus was generated by transfection of HEK-293T cells with lentiCRISPRv2 (sgC15, sgC40 or sgCtrl) and the packaging plasmids psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259 ...
-
MANF regulates unfolded protein response and neuronal survival through its ER-located receptor IRE1αbioRxiv - Cell Biology 2020Quote: ... pEZYflag and pEZYmyc-His were a gift from Yu-Zhu Zhang (Addgene plasmids #18700 and #18701). Gateway destination vectors for BiFC for N- and C-terminal tagging with Venus fluorescent protein fragments (pEZY BiFC N NV ...
-
bioRxiv - Biochemistry 2021Quote: ... The His-Sumo bacterial version was codon optimized and cloned into K27-Sumo (Addgene ID 169193) via NEBuilder HiFi DNA Assembly Cloning Kit (NEB) ...
-
bioRxiv - Cell Biology 2021Quote: ... His-Strep2-tag from 438-SNAP-V3 vector a gift from Scott Gradia (Addgene plasmid # 55223) with inserting CATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCAT sequence right in front of Strep II gene by PCR primer ...
-
bioRxiv - Biochemistry 2020Quote: MBP-hnRNPA2 LC, soluble His-tag purification as described (Ryan et al., 2018) (Addgene ID: 98661)
-
bioRxiv - Cell Biology 2019Quote: ... His-tagged SEPT5 plasmid was constructed by PCR amplifying SEPT5 from pCMV-Myc-tagged SEPT5 (Addgene plasmid # 27272 ...
-
bioRxiv - Synthetic Biology 2022Quote: A plasmid construct containing only the maturation protein and his-tagged coat protein dimer (Addgene # 179156) was transformed into Rosetta2™ (DE3 ...
-
bioRxiv - Biochemistry 2022Quote: ... coli and subcloned in-line with his-tagged MBP construct (2CT-10 vector, Addgene plasmid #55209). Recombinant MBP-EndoH fusion was expressed in and purified from E ...
-
bioRxiv - Cancer Biology 2023Quote: SULF2 ORF including C-terminal Myc-His tag was subcloned from its source vector (Addgene # 13003) to lentiviral transfer vector pHR-CMV-TetO2_3C-Twin-Strep (Addgene # 113883 ...
-
bioRxiv - Developmental Biology 2021Quote: ... GST-human β-catenin (Addgene #24193), and NLS-mCherry (Addgene #49313 ...
-
bioRxiv - Molecular Biology 2022Quote: ... pscALPSpuro-HsACE2 (human) (Addgene, MA, USA) were co-transfected with psPAX2 and pCMV-VSV-G packaging plasmids into HEK293T cells using FuGENE 6 (Promega ...
-
bioRxiv - Neuroscience 2023Quote: ... human a-SYN (A53T mutant) (Addgene), and mt-Keima (Addgene) ...
-
bioRxiv - Biochemistry 2024Quote: Recombinant human GST-CK2α’ (Addgene #27084) and recombinant human GST-CK2α (Addgene #27083 ...
-
bioRxiv - Cancer Biology 2024Quote: ORF encoding human MARK2 (Addgene, 23404) was cloned into pFL system with an N-terminal Strep2SUMO tag ...
-
bioRxiv - Biochemistry 2022Quote: ... VSV-G-pseudotyped lentivirus was generated by cotransfection of HEK-293T cells (CRL-3216, ATCC, Manassas, VA) with psPAX2 (gift from Didier Trono, Addgene plasmid #12260), pMD2.G (gift from Didier Trono ...
-
bioRxiv - Immunology 2022Quote: ... Virus was generated by transfecting the sgRNA plasmid constructs into HEK 293T cells with the psPAX2 packaging (Didier Trono, Addgene plasmid #12260) and pCMV-VSVG envelope (Bob Weinberg ...
-
bioRxiv - Cell Biology 2023Quote: ... Primary MEFs used for the long term cell migration and JLY experiments were infected with viral media from HEK cells transfected with 3x-mScarlet-FTractin (Addgene Plasmid #112960)(53) ...
-
bioRxiv - Cell Biology 2023Quote: ... GFP-MARCO-CHO and GFP-MARCO-HEK cells were further transduced with RFP-LC3 plasmid which was a gift from Tamotsu Yoshimori (Addgene, plasmid #21075) (Kimura et al ...
-
bioRxiv - Immunology 2024Quote: ... Production of lentiviral particles was performed by transient co-transfection (polyethylenimine:DNA at 3.5:1 ratio) of HEK 293T cells with the second-generation packaging system plasmid psPAX2 and pMD2.G (Addgene, 12260 and 12259). Viral supernatants were harvested at 48h post-transfection ...
-
Mediobasal hypothalamic FKBP51 acts as a molecular switch linking autophagy to whole-body metabolismbioRxiv - Neuroscience 2021Quote: ... A viral vector containing a Cre expressing cassette (pAAV-CMV-HI-eGFP-Cre-WPRE-SV40, Addgene; #105545) was used to induce Fkbp5 deletion in Fkbp5lox/lox mice ...
-
bioRxiv - Biophysics 2020Quote: ... Two plasmids containing full-length untagged Npl4 and C-terminal His-tagged Ufd1 were purchased from Addgene. Npl4 fragments were expressed in pET-28a vector with an N-terminal His-SUMO tag ...
-
bioRxiv - Biochemistry 2020Quote: hnRNPA2 LC (190-341), insoluble His-tag purification as described (Ryan et al., 2018) (Addgene ID: 98657)
-
bioRxiv - Biochemistry 2022Quote: AR-LBD (663-919) containing an N-terminal His-tag and encoded in pET15b plasmid (Addgene #89083) was expressed in Rosetta (DE3 ...
-
bioRxiv - Microbiology 2022Quote: ... HEK 293T cells in 10-cm dishes were transfected at 80% confluence with the lentiviral plasmid pLenti-CMV-Puro (Addgene plasmid no. 17452) containing the gene of interest (2 mg ...
-
bioRxiv - Neuroscience 2023Quote: ... 6 × 107 RPE1 cells were infected with the human sgRNA library (Human GeCKO v2 Library Cat#1000000048, Addgene) at an MOI of ∼0.3 ...
-
bioRxiv - Immunology 2021Quote: ... gene sequence was subcloned from pcDNA5/FRT/TO HIS HSPA1A (a gift from Harm Kampinga, Addgene plasmid # 19537; http://n2t.net/addgene:19537; RRID:Addgene_19537)(46 ...
-
bioRxiv - Biochemistry 2019Quote: ... pMAL-his-LbCpf1-EC was a gift from Jin-Soo Kim (Addgene plasmid # 79008; http://n2t.net/addgene:79008; RRID:Addgene_79008) (D ...
-
bioRxiv - Neuroscience 2020Quote: ... pEZYmyc-His (Addgene plasmid #18701; http://n2t.net/addgene:18702; RRID: Addgene_18701; a gift from Yu-Zhu Zhang [72]), that was digested with the same enzymes ...
-
bioRxiv - Biochemistry 2022Quote: Codon optimized plasmids encoding the individual His-tagged PBRM1 bromodomain constructs were received from Nicola Burgess-Brown (Addgene plasmid numbers 38999 ...