Labshake search
Citations for Addgene :
151 - 200 of 1208 citations for Mouse LIM Domain Kinase 2 LIMK2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... coli RP hk339-GFP (monomeric His-tagged Kif5B kinesin motor domain) expression plasmid was a gift from Ron Vale (Addgene plasmid #24431).
-
bioRxiv - Molecular Biology 2022Quote: ... the ACE2 and its ECT/PD domains were cloned into pBiFC-VN155 (I152L) and pBiFC-VC155 vector(Kodama and Hu, 2010) (Addgene, MA, USA). The RBD ...
-
bioRxiv - Cell Biology 2022Quote: ... expressing myristoylated FGFR1 cytoplasmic region fused with the PHR domain of cryptochrome2 and mCitrine (gift from Won Do Heo (Addgene plasmid # 59776), (Kim et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... Chimeras of the minimal domain (NTD) ORF24 homologs with ORF24 202-752 were generated using two-insert InFusion cloning (Addgene #138453-138455) into BamHI/XhoI-cut pcDNA4/TO-2xStrep (C-terminal tag).
-
bioRxiv - Pathology 2019Quote: ... antisense: CGAGTTCATGACGGCGCGCA) targeting the DID domain region of INF2 was expressed using a lentiviral plasmid (Cat. no:5296, lentiCRISPRV2, Addgene, Boston, MA). All cloned plasmids were confirmed for the correct sequence by DNA sequencing (Genewiz ...
-
bioRxiv - Synthetic Biology 2019Quote: ... AcrIIC3-LOV2 hybrid constructs were created by inserting the LOV2 domain into our published CMV-driven AcrIIC3 expression vector (Addgene plasmid #120301) (51) ...
-
bioRxiv - Cell Biology 2023Quote: ... The KT binding domain sequence of 53BP1 (aa 1235-1616) was PCR-amplified from pcDNA5-FRT/TO-eGFP-53BP1 (Addgene plasmid #60813) and cloned into pB66 downstream to the Gal4 DNA-binding domain ...
-
bioRxiv - Biochemistry 2023Quote: ... and the 6xHis-SUMO tag was removed by enzymatic cleavage using human Sentrin-specific protease 1 (SENP1) catalytic domain (derived from pET28a-HsSENP1, that was a gift from Jorge Eduardo Azevedo (Addgene plasmid #71465) at 4°C overnight27,28 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Full-length Sema6a cDNA or shortened Sema6a lacking the sequence coding for the intracellular domain (bp 2680-3766) were cloned into the pCAG-GFP vector (Addgene, Cat #11150) to obtain pCAG-promotor-driven expression of Sema6a and Sema6aΔcyt with a GFP signal sequence located upstream.
-
bioRxiv - Evolutionary Biology 2024Quote: ... we first replaced the SH3 domain with a flexible linker (GGSSGGGG) using yeast competent cells that were co-transformed with a pCAS plasmid (Addgene plasmid 60847) expressing both the gRNA of interest and Streptococcus pyogenes Cas9 and a donor DNA sequence (stuffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... pAc5.1C-FLuc-Stop-5BoxB was a gift from Elisa Izaurralde (Addgene plasmid # 21301)30 ...
-
bioRxiv - Genetics 2022Quote: ... The ecDHFR degron domain was amplified from CAG-DDdCas9VP192-T2A-EGFP-ires-puro (Addgene plasmid # 69534; http://n2t.net/addgene:69534; RRID:Addgene_69534, a gift from Timo Otonkoski). The SMASh degron domain was amplified from pCS6-SMASh-YFP ...
-
bioRxiv - Plant Biology 2022Quote: ... while the full-length coding sequence of HlMYB7 was cloned into the prey vector pGADT7-GW [DNA-binding domain (BD)] (Addgene Inc, MA, USA) using the In-Fusion Snap Assembly Kit (Takara Bio) ...
-
bioRxiv - Biochemistry 2019Quote: ... and a mammalian expression vector pcDNA3 encoding hemagglutinin tagged constitutively active glycogen synthase kinase-3β (GSK-3β) (S9A) (pcDNA3-GSK3β, # 14754, RRID: Addgene_14754). The EGFP in pRK5 vector was first replaced by iRFP to construct an iRFP tagged WT tau by golden gate assembly (pRK5-iRFP-tau ...
-
bioRxiv - Cell Biology 2021Quote: ... CHO cell lines were transfected with a reporter construct containing three copies of the PPRE placed upstream of the thymidine kinase promoter-firefly luciferase fusion gene (PPRE X3-TK-luc, Addgene). In addition ...
-
bioRxiv - Developmental Biology 2019Quote: Two gRNAs targeting loci near the start codon of the Rho kinase gene were cloned into pCFD3 vector (Addgene 49410) following the protocol from (Port et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... Select MOC1 clones that show lack of protein expression of RIP3 were transduced with inducible lentiviral vectors encoding WT (Plasmid #73701) or kinase-dead mutant (D143N) RIP3 (Plasmid #73703) purchased from Addgene (These plasmids were gifted by Dr ...
-
bioRxiv - Genetics 2023Quote: ... we first deleted the ORF with a cassette containing the hygromycin resistance marker (hphRMX) fused to the herpes simplex virus thymidine kinase-encoding gene (HSV-TK) from the pFA6a-HyTkAX vector (Addgene plasmid # 73898 ...
-
bioRxiv - Biochemistry 2020Quote: Human cDNAs of wild-type TAZ and mutants containing deletions of the WW or CC domains (gifts from Dr. Jeff Wrana: Addgene #24809, #24811, and #24816) were cloned into a pcDNA3-FLAG vector by PCR ...
-
bioRxiv - Cancer Biology 2023Quote: ... sgRNAs targeting mouse and human genes of interest (see Supplementary Table 2) were cloned into plenti-sgRNA (Addgene plasmid #71409) using BsmbI and into Cas9 plasmid (Addgene plasmid #62988)(Ran et al ...
-
bioRxiv - Cell Biology 2021Quote: ... .The KIF1C motor domain was replaced with full length human KIF1C fused to mCherry from pKIF1C-mCherry (available from Addgene 130978 (Theisen et al., 2012)) using NheI and BsrGI ...
-
bioRxiv - Plant Biology 2024Quote: ... together with a fragment containing the nucleotides encoding for the Pip1 pro-domain but lacking the signal peptide (pJK110; Supplemental Table S4) were combined in all 64 possible combinations with pICH41264 (Addgene #4799; Weber et al., 2011) in a BpiI Golden Gate reaction (Supplemental Table S4) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tag5Amyc-GSK3β S9A (constitutively active GSK3β, plasmid #16261), and Tag5Amyc-GSK3β K85A (Kinase dead GSK3β, plasmid #16262) were from Addgene (Watertown, MA). Cyclin D3 cDNA was cloned out of Rc/CMV cyclin D3 (CMV promoter ...
-
bioRxiv - Cell Biology 2020Quote: ... Lentiviral expression vector encoding the p38 MAPK Kinase Translocation Reporter (KTR) was a kind gift from Markus Covert (Addgene plasmid no. 59155). ON-TARGETplus SMARTpool siRNAs for the genes of interest as well non-targeting negative control siRNAs were obtained from Dharmacon (Lafayette ...
-
bioRxiv - Neuroscience 2020Quote: ... CRISPR guide RNA sequences (sgRNA#1 TTGTTGCCCAGGGTTTAACA and sgRNA#2 CCCATCCCCGGCACCGGGTC) targeting the mouse Nlk locus were cloned into pSpCas9n(BB)-2A-Puro (Addgene #62987; PX462). Cells were transfected with gRNA and Cas9n-expressing plasmids using Lipofectamine 2000 and successfully transfected cells were selected with 3μg ml-1 puromycin for two days ...
-
bioRxiv - Neuroscience 2021Quote: ... The BoxB reporter was pAc5.1C-Fluc-Stop-5BoxB (a gift from Elisa Izaurralde; Addgene plasmid #21301) (Behm-Ansmant et al. ...
-
bioRxiv - Cancer Biology 2023Quote: An XRN1 open-reading frame (ORF) clone deposited by Elisa Izaurralde was purchased from Addgene (#66596). The entire ORF was sequenced to confirm fidelity to the NCBI Reference Sequence NM_019001.5 ...
-
bioRxiv - Cell Biology 2022Quote: ... annealed oligos were phosphorylated in vitro with T4 polynucleotide kinase (#M0201S) from New England Biolabs (Ipswich, MA, USA) and ligated into pDR274 vector (#42250) from Addgene (Watertown, MA, USA), which was previously linearized with BsaI (#R0535 ...
-
bioRxiv - Genomics 2023Quote: To generate a functional mouse sgRNA pooled library of the pAP210 and pAP215 plasmids, we transferred the sgRNA sequences from the mCRISPRi-v2 M1 (Kinases, Phosphatases, and Drug Targets) gRNA pooled library (Addgene pooled library #83989)10 ...
-
bioRxiv - Neuroscience 2020Quote: One adult mouse (~ 2 months) was stereotaxically injected with a GCaMP6f construct (AAV5.CamKII.GCaMP6f.WPRE.SV40 virus, Addgene # 100834; 0.4 μL at 0.06 μl/min) in hippocampal CA1 ...
-
bioRxiv - Bioengineering 2023Quote: Full length plasmid of PI3KCA (phosphatidylinositol-4,5-biphosphate 3-kinase catalytic subunit alpha, NM_006218.4) was purchased from Addgene (Plasmid ID: 81736, Hahn and Root Lab). The coding sequence of PI3KCA was cloned into Lenti-PCDH-EF1-mNeonGreen-MCS-T2A-puromycin plasmid (a kind gift from Fırat-Karalar Lab ...
-
bioRxiv - Cell Biology 2023Quote: ... pT7-EGFP-C1-HsDCP1a was a gift from Elisa Izaurralde (Addgene plasmid # 25030; http://n2t.net/addgene:25030;RRID:Addgene_25030) (Tritschler et al. ...
-
bioRxiv - Genetics 2020Quote: A pair of TALENs targeting zebrafish tnfaip3 (A20) exon 2 were generated using “PLATINUM Gate TALEN Kit” (Addgene, #1000000043). 0.2 ng of mRNA encoding the TALEN pair was delivered into the cytoplasm of wild-type zebrafish embryos at the one-cell stage ...
-
bioRxiv - Bioengineering 2022Quote: ... with 2 μg MLC-2 plasmid (pEGFP-MRLC1, Addgene, #35680), 10 μg RAR-β siRNA (Santa Cruz ...
-
bioRxiv - Neuroscience 2023Quote: ... virus for optogenetic inhibition or excitation of preBötCOT-R neurons in OT-R::Cre mice was obtained from Addgene (Table 2, Addgene viral prep # 154951 ...
-
bioRxiv - Neuroscience 2023Quote: ... The AAV1-phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE virus for tracing experiments from preBötCOT-R neurons to nACardiac neurons in OT-R::Cre mice was obtained from Addgene (Table 2, Addgene viral prep # 51509 ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse TRIM21 (Addgene #105516) and CRY2Clust (Park et al. ...
-
bioRxiv - Developmental Biology 2020Quote: ... mouse Ebf1 cDNA (Addgene) was cloned into pLVX Tet-One Puro plasmid (Clontech) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... mouse Gqα15 (Addgene #40753) (Offermanns and Simon ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV2/2 (Addgene 104963), adenovirus helper plasmid pAdDeltaF6 (Addgene 112867 ...
-
bioRxiv - Microbiology 2020Quote: ... The plentiCRISPRV.2 (Addgene) was digested with BsmBI and ligated with guide RNA sequences specific for IFNAR1 ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/2 (Addgene #104963), pAAV2/5 (Addgene #104964) ...
-
bioRxiv - Genomics 2020Quote: The CRISPR/Cas9 plasmid (CTCF-mouse-3sgRNA-CRISPRexp-AID) was assembled using the Multiplex CRISPR/Cas9 Assembly System kit57 (a gift from Takashi Yamamoto, Addgene kit #1000000055). Oligonucleotides for three gRNA templates were synthesized ...
-
bioRxiv - Neuroscience 2021Quote: ... or KH1*KH2* mutants were PCR amplified from their respective pAc5.1B-EGFP vector and cloned into the HindIII and EcoRI sites of the pAc5.1-lambdaN-HA vector (a gift from Elisa Izaurralde; Addgene plasmid #21302) (Behm-Ansmant et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... was PCR amplified and cloned downstream of EGFP in the pAc5.1B-EGFP vector (a gift from Elisa Izaurralde; Addgene plasmid #21181) using the HindIII and EcoRI restriction sites to make pAcB5.1-EGFP-FMRP ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmids for SARS-CoV-2 structural proteins were purchased from Addgene (Appendix Table 2). Lentiviral supernatant was collected according to the manual using 293FT cells ...
-
bioRxiv - Cancer Biology 2019Quote: ... shNRF2 #2 (TRCN0000284998, Addgene #136585), shJUND #1 (TRCN0000416347 ...
-
bioRxiv - Cancer Biology 2019Quote: ... shJUND #2 (TRCN0000416920, Addgene #136583).
-
bioRxiv - Genomics 2019Quote: ... pMDG.2 (3.2µg; Addgene #12259), TKOv3 plasmid library (8µg) ...
-
bioRxiv - Biophysics 2022Quote: ... 2 μg BFP-KDEL (Addgene plasmid #49150 ...