Labshake search
Citations for Addgene :
151 - 200 of 3035 citations for Mono 3 Carboxypropyl Phthalate 100 Ug Ml In Mtbe Ring 1 2 13C2 Dicarboxyl 13C2 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: cDNA from Source BioSicence clone C130076G01 was amplified with PCR adding restriction sites for NheI at 5’ end and AgeI at 3’ end (Supplementary Table 2) and cloned into pLIX_402 vector (a gift from David Root, Addgene #41394) using restriction ligation ...
-
bioRxiv - Biochemistry 2022Quote: Expression plasmid (pGEX-5X-3-SARS-CoV-2-3CL) was a gift from Alejandro Chavez & David Ho & Sho Iketani (Addgene plasmid # 168457 ...
-
bioRxiv - Genetics 2019Quote: ... and guide 2 c(3)GccΔ3: TCTTGAACAACAATCTGTCAAGG) and constructed into the pU6-BbsI-chiRNA guide RNA (gRNA) plasmid (Addgene 45946). Sense and antisense oligonucleotides (guide 1 c(3)GccΔ2 ...
-
bioRxiv - Microbiology 2021Quote: ... A gRNA sequence 5’-GGATGGGATCTTGGCGCACG-3’ targeting intronic sequence immediately prior to Exon 2 of Ace2 was cloned into the eSpCas9(1.1) plasmid (Addgene 71814). A targeting construct was designed to insert by homologous recombination the human ACE2 cDNA followed by a floxed WPRE-SV40 polyA and FRT-ed neomycin resistance cassette directly after the ATG-start codon of mouse Ace2 in exon 2 ...
-
bioRxiv - Genomics 2021Quote: ... iPSCs were transfected with pRT43 containing DHFR-dCas9-VPH and TALENS targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT- C13-L1, gifts from Jizhong Zou (Addgene plasmid # 62196 ...
-
bioRxiv - Neuroscience 2021Quote: Cultured Cdh11 wild-type and knockout hippocampal neurons (300,000 cells/2 cm2) were transfected at 3 DIV or 9 DIV with the pLL3.7-GFP vector (Addgene Cat#11795) using Lipofectamine 2000 (Invitrogen Cat#11668-019 ...
-
bioRxiv - Bioengineering 2023Quote: ... OCI-AML-2 and OCI-AML-3) were retrovirally transduced with MI-Luciferase-IRES-mCherry (gift from Xiaoping Sun, Addgene plasmid #75020 ...
-
bioRxiv - Neuroscience 2023Quote: ... 1.0 µL of pAAV.Syn.Flex.GCaMP6s.WPRE.SV40 (diluted 1:2 in dPBS; Addgene: 100845-AAV5 ...
-
Microbial signals and lymphotoxin drive TNF-independent death of A20 and ABIN-1 deficient epitheliumbioRxiv - Immunology 2021Quote: ... followed by a GSG linker and mouse IgG2a Fc fusion (amino acid 99-330; UniProtKB/Swiss-Prot P01863) were synthesized and then cloned into pENTR (Addgene Plasmid #17398) using InFusion cloning according to manufacturer’s instructions (Clontech) ...
-
bioRxiv - Biochemistry 2021Quote: DNA encoding amino acids Phe2-Asp101 of human CGI-99 was cloned into the UC Berkeley MacroLab 1B vector (Addgene plasmid # 29653). The fusion protein containing an N-terminal His6 tag and a TEV protease cleavage site was expressed in BL21 (DE3 ...
-
bioRxiv - Developmental Biology 2021Quote: ... The injection mix was prepared in MilliQ H2O and contained 60 ng/mL Peft-3::Cas9 (Addgene #46168), 45 ng/mL each sgRNA plasmid ...
-
bioRxiv - Developmental Biology 2021Quote: ... Injection mixes were prepared in MilliQ H2O and contained 50 ng/ml Peft-3::cas9 (Addgene ID #46168) (Friedland et al. ...
-
bioRxiv - Microbiology 2022Quote: ... 2.54 ug of the VSV-G expression plasmid pMD2.G (a gift from Didier Trono, Addgene plasmid # 12259), and 6.42 ug of the appropriate helper construct (pHit-CMV-GagPol (55 ...
-
bioRxiv - Genomics 2023Quote: AAV production was performed by transfecting 293FT cells with 22 ug of pDGM6 helper plasmid (Addgene plasmid # 110660), 6 ug of donor template plasmid ...
-
bioRxiv - Biophysics 2023Quote: ... total transfected DNA mass was kept at 10 ug for each condition using empty pBSK vector (Addgene # 212205). 500 ul Opti-MEM medium containing 20 ul Lipofectamine 3000 reagent was subsequently added to the plasmid containing mixture and incubated at RT for 15 mins ...
-
bioRxiv - Immunology 2023Quote: ... and 5 ug pCMV-VSV-G (kind gift from Bob Weinberg (Addgene plasmid #8454; http://n2t.net/addgene:8454; RRID:Addgene_8454) using Lipofectamine 3000 (Invitrogen) ...
-
bioRxiv - Cancer Biology 2024Quote: ... with 7.5 ug of the Human Improved Whole-Genome Knockout CRISPR library V1 (by Kosuke Yuya, Addgene #67989), 18.5 ug of psPax2 ...
-
bioRxiv - Cell Biology 2021Quote: ... pcDNA3-HA-14-3-3 beta (14-3-3β) was a gift from Michael Yaffe (Addgene #13270). pclbw-opa1(isoform 1)-myc (myc-Opa1 ...
-
bioRxiv - Microbiology 2023Quote: ... ATG16L1 shRNA (5’-GTCATCGACCTCCGGACAAAT-3’) was inserted into pLKO.1 puro (Addgene plasmid #8453) to generate pLKO.1-ATG16L1-shRNA ...
-
bioRxiv - Cancer Biology 2023Quote: ... sh2: 5-CCAACAACATCTTCTGCTCC-3’ were cloned into the lentiviral vector pLKO.1 (Addgene #8453)[16] ...
-
bioRxiv - Genomics 2022Quote: ... gRNAs were constructed from pSLQ2853-3 pHR: U6-Sasgv2CXCR4-1 CMV-EGFP (Addgene 84254) and pSLQ1852-2 pHR ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.75 µL of rgAAV-FLEX-tdTomato (diluted 1:3 in dPBS; Addgene number: 28306) was injected in TH-Cre mice in basal forebrain (AP ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2μg of target shRNA construct and 2μg of 3:1 ratio of psPAX2 (Addgene) and pMD2.G (Addgene ...
-
bioRxiv - Plant Biology 2024Quote: ... for Level 1 and 3 and pEven1-4 (pCsA-E, Addgene plasmids # 136067-136070) for Level 2 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 2.5 ng/mL Pmyo-2::mCherry as a co-injection marker (pCFJ90, Addgene #19327). Microinjection of adult N2 hermaph-rodites was performed as described above ...
-
bioRxiv - Molecular Biology 2022Quote: ... a 2 mL transfection mixture containing lentiviral packaging plasmids 7.5 µg pMD2.G (#12259, Addgene), 11.4 µg pMDLg-RRE (#12251 ...
-
bioRxiv - Neuroscience 2023Quote: ... Retro-AAV2 coding for mCherry (pAAV2-hSyn-mCherry, Addgene #114472, 2 x 1013 GC/ml) and green fluorescent protein (pAAV2-hSyn-eGFP ...
-
bioRxiv - Molecular Biology 2019Quote: ... Injection mix consisted of 0.5pmol/ul in vitro transcribed RNA and 2.5ng/ul co-injection marker (pmyo-2::mCherry::unc-54 3’UTR) plasmid pCFJ90 (Addgene, plasmid #19327), dissolved in water ...
-
bioRxiv - Cancer Biology 2019Quote: ... a 20-mer sgRNA target sequence (5′-CTCAGAGGGGGCTCGACGCT-3′) at exon 2 of the TP53 gene was designed (28) and cloned into pX330 (Addgene #42230), which was a gift from Dr ...
-
bioRxiv - Developmental Biology 2023Quote: Two gRNAs were designed to target the exon 3 of REV1 (Supplementary Table 2) and subcloned into the PX458 plasmid (Addgene, 48138). 5.0-8.0 × 105 BTAG cells were electroporated with 3 μg of each gRNA using Amaxa 4D nucleofector (Lonza ...
-
bioRxiv - Neuroscience 2023Quote: ... oligos encoding guide RNAs targeting intron 2 and intron 3 of murine Dyrk1a were cloned into plasmid pX459 v2.0 (Addgene plasmid # 62988) and sequence verified ...
-
bioRxiv - Microbiology 2021Quote: Chemical-genetic screens were initiated by thawing 5 × 1 mL (1 OD600 unit per mL) aliquots of the Mtb CRISPRi library (RLC12; Addgene #163954) and inoculating each aliquot into 19 mL 7H9 supplemented with kanamycin (10 μg/ml ...
-
bioRxiv - Plant Biology 2022Quote: ... 100 ng of Golden Gate recipient vector (pYPQ143; Addgene, USA; Table 1), 0.5 μl BsaI (NEB) ...
-
bioRxiv - Cell Biology 2020Quote: ... Injection mixes were prepared in MilliQ H O and contained 50 ng/ml Peft-3::cas9 (Addgene ID #46168) (Friedland et al. ...
-
bioRxiv - Microbiology 2021Quote: ... Expression vectors for SARS-CoV-2 Wuhan-Hu-1 (Addgene, #149539), SARS-CoV-2 B.1.167.2 (Addgene ...
-
bioRxiv - Cancer Biology 2021Quote: ... gRNA-1 and -2 were cloned into pL-CRISPR.EFS.GFP (Addgene, #57818) and pL-CRISPR.EFS.tRFP (Addgene plasmid #57819) ...
-
Zero-shot learning enables instant denoising and super-resolution in optical fluorescence microscopybioRxiv - Bioengineering 2023Quote: ... and the sgRNA was ligated into pX330A-1×2 (Addgene, 58766). To construct donor vector ...
-
bioRxiv - Genomics 2022Quote: ... and pSLQ1852-2 pHR: U6-SpsgCD95-1 CMV-EGFP (Addgene 84151) with slight modifications ...
-
bioRxiv - Microbiology 2022Quote: ... All shRNAs were generated by cloning shRNA hairpin sequences found in Table 3 into pLKO.1-TRC Puro (pLKO.1-TRC cloning vector was a gift from David Root (Addgene plasmid # 10878 ...
-
bioRxiv - Molecular Biology 2021Quote: ... of 14-3-3 theta into pEBFP2-C1 (Addgene plasmid #54665). A CHIP plasmid78 was a gift from Leonard Petrucelli and the CHIP ORF was cloned into pCMV-C2-6myc ...
-
bioRxiv - Cell Biology 2022Quote: ... GFP-Galectin-3 was subcloned from ptf-Galectin-3 (Addgene: 64149). pMXs-puro eGFP-p62 was a gift from Noboru Mizushima (Addgene plasmid # 38277 ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 + 3 gRNAs targeting either side of the +3 kb enhancer core region (targeting sequences listed in Supplementary Table 2) were cloned into pX330 vector (Addgene plasmid #42230). mESCs were co-transfected with a mixture of all 6 CRISPR plasmids and a plasmid containing a blasticidin expression cassette for selection ...
-
bioRxiv - Cell Biology 2019Quote: ... was generated by transfecting HEK293T cells with pC13N-dCas9-BFP-KRAB26 and TALENS targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using DNA-In Stem (VitaScientific) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Clones were generated using oligonucleotide primers listed in Supplementary Table 2-3 to amplify the gene fragment from cDNA and cloned into the vector pJC53.2 (Addgene Plasmid ID: 26536)60 ...
-
bioRxiv - Cell Biology 2023Quote: ... iPSCs were transfected with pC13N-dCas9-BFP-KRAB and TALENS targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using DNA In-Stem (VitaScientific) ...
-
bioRxiv - Bioengineering 2023Quote: ... iPSCs were transfected with LSD-dCas9-BFP-KRAB and TALENS targeting the human CLYBL safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using transfection reagent ...
-
bioRxiv - Immunology 2024Quote: ... were carried out as following: MaSCs (passage 2-3) were transduced with sgP53 or sgNT cloned into lentiCRISPRv2-puro (Addgene, Plasmid #98290), passaged once ...
-
bioRxiv - Neuroscience 2022Quote: AAV2/1 hsyn-jGCaMP8m-WPRE (Addgene, 2.0E13 GC/ml)
-
bioRxiv - Neuroscience 2022Quote: AAV2/1 hSyn-SF-iGluSnFR.A1848 (Addgene, 3E12 GC/ml)
-
bioRxiv - Neuroscience 2022Quote: AAV2/1 hsyn-jGCaMP8s-WPRE (Addgene, 2.8E13 GC/ml)