Labshake search
Citations for Addgene :
151 - 200 of 1747 citations for L β Homo β 2 hydroxyphenyl glycine; R 3 Amino 3 2 hydroxyphenyl propanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... mCherry-ER-3 (Addgene, Watertown, MA), or Perilipin1-YFP[41] following established protocols[32] ...
-
bioRxiv - Cell Biology 2024Quote: ... and 3 μg pMD2.G (Addgene) were transfected into 293T cells at 80% confluency in a 10-cm dish with 8 ml of media ...
-
bioRxiv - Genetics 2021Quote: pWallium-dCas9-VPR (containing homo sapien codon optimized dCas9m4; Addgene# 78897 (Lin et al., 2015)) was digested with NdeI/EcoRI ...
-
bioRxiv - Cell Biology 2024Quote: ... The amino acid sequence of bPAC was obtained from pGEM-HE-h_bPAC_cmyc (Addgene plasmid #28134) (Stierl et al ...
-
bioRxiv - Cell Biology 2020Quote: ... Wild-type β-PheRS cDNAs were cloned into the pET LIC (2A-T) plasmid (Addgene). Then ...
-
bioRxiv - Cell Biology 2023Quote: ... Flag-KD-IKKβ (K44M) (Cat# 11104) and HA-β-TrCP2 (Cat# #36969) were from Addgene. Flag-CA-IKKα (S176E ...
-
bioRxiv - Neuroscience 2022Quote: TALENs (AAVS1-TALEN-L and AAVS1-TALEN-R; Addgene, 59025/59026)(Gonzalez et al. ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and Homo sapiens (Hs) were cloned into the constitutive eukaryotic expression vector pcDNA3.1(+) acquired from Addgene using KpnI and XhoI restriction enzymes ...
-
bioRxiv - Cell Biology 2022Quote: ... annealed oligo (5’-CACCGATGACCAACGACGCAAGTTT-3’ and 5’-AAACAAACTTGCGTCGTTGGTCATC-3’) was inserted into PX459 (pSpCas9(BB)-2A-PuroV2.0) (Addgene) (Ran et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... The entire coding sequence of GCaMP6s was amplified by PCR with primers 5’–GGATCCGCCACCATGGGTTCTCATCATCATCA–3’ and 5’–GTAGCCGAACCGGTCTTCGCTGTCATCATTTGTAC–3’ using pGP-CMV-GCaMP6s (Addgene plasmid # 40753; http://n2t.net/addgene:40753; RRID:Addgene_40753) as a template ...
-
bioRxiv - Neuroscience 2020Quote: ... Lin Tian)56 using Q5 polymerase (primers: 5’-aaaagctagcatgaagacgatcatcgccctgagc-3’ and 5’-aaaaaggcgcgcctcaggttgggtgctgaccg-3’) and subcloned into pAAV.CBA.DIO (Addgene #81008)108 backbone between AscI and NheI restriction sites ...
-
bioRxiv - Molecular Biology 2023Quote: gRNAs targeting LSM14A (5’-TCTGTACCAAAGGATCGAAC-3’) and XRN1 (5’-AGAGAAGAAGTTCGATTTGG-3’) were cloned into LentiCRISPR v2 (Addgene #52961) using BsmBI restriction enzyme sites and confirmed by sequencing ...
-
bioRxiv - Neuroscience 2023Quote: ... neonatal Swiss Webster or C57Bl/6 (P0–3) mice were anesthetized on ice for 3 min before injecting viral vectors (AAV5.GfaABC1D.GCaMP6f.SV40 [Addgene, 52925-AAV5] ...
-
bioRxiv - Biochemistry 2022Quote: ... The wild-type 14-3-3 ζ gene was cloned into NcoI/XhoI digested pBAD plasmid (Addgene #85482) with a TEV cleavable C-terminal His6 purification tag ...
-
bioRxiv - Molecular Biology 2024Quote: ... Two guide RNA sequences were selected to target exon 1 of mtIF3 as described previously (5′-GCAAUAGGGGACAACUGUGC-3′ and 5′-GCAGAGUAUCAGCUCAUGAC-3′) 59 and cloned into the pL-CRISPR.EFS.GFP (a gift from Benjamin Ebert, Addgene plasmid # 57818 ...
-
bioRxiv - Biochemistry 2024Quote: ... The 3×HA and 3×HA-GFP sequences were cloned from pMXs-3XHA-EGFP-OMP25 plasmid (Addgene 83356).
-
bioRxiv - Genomics 2020Quote: ... pCFJ104 - Pmyo-3∷mCherry∷unc-54 (Addgene plasmid # 19328 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 3 μg psPAX2 (packaging plasmid; Addgene) was performed using iN-fect (Intron Biotechnology ...
-
bioRxiv - Cell Biology 2021Quote: ... and pGH8 (Prab-3::mCherry, Addgene #19359) (Frøkjaer-Jensen et al. ...
-
bioRxiv - Genomics 2022Quote: ... and 3 μg pMD2.G (Addgene, #12259) into 293T cells cultured in 100 mm dish ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 μg of pGW-PervevalHR (Addgene #57432) (22) ...
-
bioRxiv - Immunology 2021Quote: ... myc (pCSF107mT-GATEWAY-3’-Myc tag, Addgene), green fluorescence protein (GFP ...
-
bioRxiv - Genomics 2023Quote: ... with 3 μg of psPAX (Addgene, 12260) and 1 μg of pMD2.G (Addgene ...
-
bioRxiv - Neuroscience 2022Quote: ... +0.4 ML with diluted (1:3; Addgene) 4 × 0.15 μL of AAV9-Synapsin-jGCaMP7f-WPRE (Addgene) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... MAFA in pX330S-3 (Plasmid #58779, Addgene), Insulin in pX330S-4 (Plasmid #58780 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 3 μg of pVSVg (8454; Addgene); FuGENE HD transfection reagent (Promega ...
-
bioRxiv - Genetics 2022Quote: ... Tc’hsp5’-Gal4Delta-3’UTR] (Addgene plasmid # 86449) was used as a donor plasmid with Piggybac insertion repeats and the 3xP3::EGFP reporter (Schinko et al. ...
-
bioRxiv - Physiology 2023Quote: ... and mPlum-mito-3 (Addgene plasmid #55988) using Fugene6 (Promega Inc. ...
-
bioRxiv - Immunology 2024Quote: ... pcDNA-HA-14-3-3β (Addgene #13270), pcDNA-HA-14-3-3σ (Addgene #11946 ...
-
bioRxiv - Immunology 2024Quote: ... pCS2-HA-14-3-3ε (Addgene #116886), pCS2-HA-14-3-3ζ (Addgene #116888 ...
-
bioRxiv - Immunology 2024Quote: ... pcDNA-HA-14-3-3σ (Addgene #11946) and pGEX-4T2-14-3-3 tau (θ ...
-
bioRxiv - Immunology 2024Quote: ... pCS2-HA-14-3-3ζ (Addgene #116888) and pCS2-HA-14-3-3η (Addgene #116887 ...
-
bioRxiv - Cancer Biology 2024Quote: ... The N-Terminal pFLAG 3 vector (Addgene) was employed for cloning the DCLK1 DCX DNA by restriction digest ...
-
bioRxiv - Cell Biology 2024Quote: ... the vector pET-28a (#69864-3, Addgene) was amplified using 5’-GAAGCGGCCGCCCCGTCTCGTCTGGAAGAAGAACTGCGTCGTCGTCTGACCG AATAACACCACCACCACCACCACCACTGAGATCCGGC and 5’-GCCGGATCCGTGATGATGATGATGATGGCTGCTGCCC to introduce NotI and BamHI restriction sites into the vector backbone ...
-
bioRxiv - Cell Biology 2020Quote: ... and β-Actin DNA (Actin mRFP-PAGFP was a gift from Guillaume Charras & Tim Mitchison, RRID:Addgene_62382) into the third-generation lentiviral plasmid pCDH-EF1-IRES-Puro (System Biosciences).
-
bioRxiv - Neuroscience 2023Quote: ... The DNA plasmids consisted of: Cre recombinase under the Chicken β-actin (CAG) promoter (#13775, Addgene), Cre-dependent stGtACR2-FusionRed under the hSyn1 promoter (#105677 ...
-
bioRxiv - Cancer Biology 2024Quote: ... After 32 hours cells were transfected with an equimolar mix of CK2α/β plasmid (Addgene; #27093) and the relevant MCAM tail variant ...
-
bioRxiv - Cell Biology 2024Quote: ... mCherry-Sec61-β was a gift from Gia Voeltz (Zurek et al., 2011; Addgene plasmid #49155). mEmerald-Sec61β-C1 was a gift from Jennifer Lippincott-Schwartz (Nixon-Abell et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... n=2) or AAV9.EF1a.dflox.hChR2(H134R).EYFP.WPRE.HGH (1×10^12 pp/mL, Addgene, cohort 2, n=2). Subject mice were additionally injected in vCA2 (AP −3.0 ...
-
bioRxiv - Bioengineering 2022Quote: ... with 2 μg MLC-2 plasmid (pEGFP-MRLC1, Addgene, #35680), 10 μg RAR-β siRNA (Santa Cruz ...
-
bioRxiv - Neuroscience 2023Quote: ... virus for optogenetic inhibition or excitation of preBötCOT-R neurons in OT-R::Cre mice was obtained from Addgene (Table 2, Addgene viral prep # 154951 ...
-
bioRxiv - Neuroscience 2023Quote: ... The AAV1-phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE virus for tracing experiments from preBötCOT-R neurons to nACardiac neurons in OT-R::Cre mice was obtained from Addgene (Table 2, Addgene viral prep # 51509 ...
-
bioRxiv - Cell Biology 2020Quote: ... 25 ng/µl of co-injection marker pCFJ104 (Pmyo-3:mCherry:unc-54 3’UTR, a gift from Erik Jorgensen, Addgene plasmid #19328 ...
-
bioRxiv - Neuroscience 2022Quote: ... The cDNA of Ncam2.1 was amplified from the pCNcam2.1 with 5’-ACCATGAGCCTCCTCCTCTCC-3’ and 5’-CTGACCAAGGTGCTGAAACT-3’and cloned into pWPI (Plasmid #12254, Addgene) within PmeI site to obtain the pWPI-NCAM2.1 ...
-
bioRxiv - Neuroscience 2022Quote: ... The cDNA of Ncam2.2 was amplified with 5’-ACCATGAGCCTCCTCCTCTCC-3’ and 5’-TCTCTGATCAGGGAGTACCA-3’ and cloned into pWPI (Plasmid #12254, Addgene) within PmeI site to obtain the pWPI-NCAM2.2.
-
bioRxiv - Genetics 2023Quote: ... GFP-3’UTR was PCR amplified using primers (5’-AGCTTGCATGCCTGCAGGTCG-3’ and 5’-AAGGGCCCGTACGGCCGACTA-3’) and plasmid pPD95.75 (Plasmid #1494-Addgene) as the template ...
-
bioRxiv - Molecular Biology 2024Quote: ... SK-BR-3 HER2-knockout (SK-BR-3 KO) were obtained using pSpCas9 BB-2A-Puro (PX459) V2.0 (9200 bp, Addgene) containing a sgRNA sequence (5’-TCATCGCTCACAACCAAGTG-3’ ...
-
bioRxiv - Cell Biology 2024Quote: ... were constructed by inserting annealed synthetic oligomers (5′-CACCgcagctcctgcctctcatcg-3′ and 5′-AAACcgatgagaggcaggagctgc-3′) into the Bbs I site of pX330-U6-Chimeric_BB-CBh-hSpCas9 vector (#42230; Addgene, Watertown ...
-
bioRxiv - Biochemistry 2024Quote: Synthetic complementary oligos targeting POLDIP2 (5’-CACCGCGCGTCGTCGTGGTCGACGC-3’ and 5’-AAACGCGTCGACCACGACGACGCGC -3’) were cloned into PX459-SpCas9 (Addgene, (35)) at the BbsI site ...
-
bioRxiv - Genetics 2024Quote: ... We transduced hiPSCs from two control donors (553-3, male; 3182-3, female) with lentiviral pUBIQ-rtTA (Addgene #20342) and tetO-NGN2-eGFP-NeoR (Addgene #99378 ...