Labshake search
Citations for Addgene :
151 - 200 of 762 citations for Human ADH5 siRNA since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: Human TREX1 sequences were derived from plasmid GFP-TREX1 (Addgene 27219) and TREX1-D18N (Addgene 27220).
-
bioRxiv - Cell Biology 2023Quote: Plasmid containing CDS sequences of human MCU were taken from Addgene and restriction digestion was performed ...
-
bioRxiv - Microbiology 2023Quote: ... The cDNA encoding human cGAS (NM_138441.3) was purchased from Addgene (#108674) and subcloned into pEGFP-C3 vector.
-
bioRxiv - Biochemistry 2023Quote: ... The human RTCB gene was inserted into the 438B (Addgene: 30115) plasmid and the 438-Rgfp (Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: ... Human DNMT1 plasmid was purchased from Addgene (#36939, Watertown, MA, USA) (Li et al. ...
-
bioRxiv - Immunology 2023Quote: Human CD86 C-terminally tagged with enhanced GFP (pCD86-EGFP, Addgene) was sub-cloned into a modified version of the MSCV2.2 retroviral plasmid in which the IRES-GFP cassette was removed ...
-
bioRxiv - Cancer Biology 2023Quote: Human GBM cells were transduced with the 7TGC (Addgene plasmid #24304), 7TGC-SFRP1 or 7TGC-Notum lentiviral vectors at a multiplicity of infection (MOI ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... or the human IFN-beta promoter (IFN-Beta-pGL3, Addgene #102597), renilla luciferase fused to herpes simplex virus thymidine kinase promoter (pTK-Renilla ...
-
bioRxiv - Genomics 2024Quote: ... GRCh38.p13 (human) and eGFP (sequence obtained from FUGW Addgene #14883) and tdTomato (sequence obtained from pCSCMV ...
-
bioRxiv - Genetics 2024Quote: Human FIGNL1 sgRNAs (table below) were cloned into pDG458 (Addgene #100900) plasmid at BbsI site on both side of Cas9 expression plasmid ...
-
bioRxiv - Biophysics 2021Quote: Human ACE2 (hACE2) cDNA was obtained from Addgene (#1786; Watertown, MA, USA). To construct an expression plasmid ...
-
bioRxiv - Cancer Biology 2021Quote: The Human CRISPR knockout Pooled Library (GeCKOv2) was purchased from Addgene (#1000000048) and amplified using E ...
-
bioRxiv - Cancer Biology 2021Quote: ... and then infected with human telomerase reverse transcriptase (hTERT)-containing lentivirus (AddGene) per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... pEGFP-LC3 (human) plasmid construct was purchased from Addgene (catalog number 24920). All mutant ATG9a ...
-
bioRxiv - Cell Biology 2020Quote: Human SAR1 was subcloned into pLenti-puro (Addgene Cambridge, MA; Plasmid #39481). The plasmid containing SAR1 was transfected with Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Cell Biology 2022Quote: ... cDNA encoding human Dnm1 wild-type was amplified from Dnm1-pmCherryN1 (Addgene #27697 ...
-
Rab35 Governs Apicobasal Polarity Through Regulation of Actin Dynamics During Sprouting AngiogenesisbioRxiv - Developmental Biology 2022Quote: ... pcDNA3-HA-human OCRL (gift from Pietro De Camilli, Addgene plasmid # 22207); pCDNA3.0_mitoLAMA-G97 (gift from Kai Johnsson ...
-
bioRxiv - Cancer Biology 2020Quote: The Brunello CRISPR library targeting the human genome was obtained from Addgene (via John Doench and David Root ...
-
bioRxiv - Cancer Biology 2020Quote: ... human PML SUMO-1 mutant and GFP-BLM were purchased from Addgene (#62804 ...
-
bioRxiv - Systems Biology 2021Quote: The human Toronto knockout v3 (TKOv3) genome-scale CRISPR library (Addgene #90294) was used to perform pooled CRISPR knockout screens in Vero E6 ...
-
bioRxiv - Microbiology 2020Quote: ... The pmCherry-human vinculin (HV) and pmCherry-VASP plasmids were from Addgene. Stealth siRNA anti-human vinculin was from Invitrogen (reference number 1299001) ...
-
bioRxiv - Microbiology 2020Quote: ... The pmCherry-human vinculin (HV) and pmCherry-VASP plasmids were from Addgene. Stealth siRNA anti-human vinculin was from Invitrogen (reference number 1299001) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 13.8μg of Human CRISPR Knockout Pooled Library (GeCKO v2) (Addgene # 1000000049) part A or part B were combined with Lipofectamine 3000 (Thermo Fisher Scientific # L3000015 ...
-
bioRxiv - Cell Biology 2020Quote: ... A negative selection cassette with human thymidine kinase was retrieved from Addgene #21911 (41) ...
-
bioRxiv - Neuroscience 2021Quote: ... The human CD68 promoter32 was cloned into the lentiviral vector FG12 (Addgene) using XbaI and XhoI sites ...
-
bioRxiv - Immunology 2021Quote: Plasmid encoding human ACE2 (hACE2) was obtained from Addgene (hACE2; catalog #1786). The hACE2 2.6 kbp ORF was also blunt-cloned into a third generation HIV vector 3’ of CMV promoter and 5’ of an IRES- puror cassette to generate pHIV-CMV-hACE2-IRES-Puro ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human EGFRvIII expression was induced using pMSCV-XZ066-EGFRvIII (Addgene, plasmid 20737) and murine hEGFRvIII+ B-ALL cells were generated ...
-
bioRxiv - Biophysics 2022Quote: ... The His6-SUMO tag was subsequently cleaved with human SenP1 (Addgene #16356) 27 and separated on Ni2+-Histrap HP column ...
-
bioRxiv - Biochemistry 2022Quote: ... The full-length human PIK3R5 (p101) gene was purchased from Addgene (70464), and the full-length human PIK3R6 (p84 ...
-
bioRxiv - Neuroscience 2022Quote: ... pEGFP-LC3 (human) was a gift from Toren Finkel (Addgene, Plasmid #24920). pMXs GFP-LC3-RFP was a gift from Noboru Mizushima (Addgene ...
-
bioRxiv - Biochemistry 2022Quote: ... Human TXNRD1 sequence was cloned from a cDNA provided by Addgene (#38863), and TXNRD2 was synthesized as a gBlock gene fragment by IDT ...
-
bioRxiv - Cell Biology 2024Quote: Transfection experiments were done with human WT PCMVHA hEZH2 plasmid (#24230, Addgene), a kind gift from Dr ...
-
bioRxiv - Cancer Biology 2023Quote: The human Insulin Receptor cDNA was a gift from Frederick Stanley (Addgene plasmid # 24049 ...
-
bioRxiv - Cancer Biology 2024Quote: The human CRISPR Brunello lentiviral pooled library (Addgene # 73178-LV)14 and human CRISPR Dolcetto (Set A) inhibition library (Addgene # 92386-LV)15 were used to identify genes responsible for enhanced survival of PANC-1 cells treated with nab-paclitaxel ...
-
bioRxiv - Cell Biology 2023Quote: ... tagBFP-Rab35 (Human Rab35; in lentivirus vector pLVX-M-puro (Addgene 125839)) ...
-
bioRxiv - Microbiology 2022Quote: ... The human codon-optimized T7 polymerase plasmid was obtained from Addgene (#65974) and the CVB3 infectious clones encoding mCherry (CVB3-mCherry ...
-
bioRxiv - Cell Biology 2023Quote: ... pEGFP-N1 human cofilin-1 S3E (gift from James Bamburg; Addgene 50861), pEGFP-N1 human cofilin-1 S3A (gift from James Bamburg ...
-
bioRxiv - Cell Biology 2023Quote: ... pEGFP-N1 human cofilin-1 WT (gift from James Bamburg; Addgene 50859), pEGFP-N1 human cofilin-1 S3E (gift from James Bamburg ...
-
bioRxiv - Cell Biology 2023Quote: ... pEGFP-N1 human cofilin-1 S3A (gift from James Bamburg; Addgene 50860) cofilin-1 (Garvalov et al. ...
-
bioRxiv - Developmental Biology 2023Quote: ... The human TBXT sgRNA (CAGAGCGCGAACTGCGCGTG) was a gift from Jacob Hanna (Addgene plasmid #59726 ...
-
bioRxiv - Biochemistry 2023Quote: GST-tag human HP1⍺ was a kind gift from Naoko Tanese (Addgene plasmid # 24074 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... human LOXL2 was amplified from plasmid pQXCINeo-LOXL2-BC [bought from Addgene, catalog number #134763] ...
-
bioRxiv - Synthetic Biology 2024Quote: ... human TG2 was amplified from plasmid W118-1_hTGM2-Flag [bought from Addgene, catalog number #180407] ...
-
bioRxiv - Neuroscience 2024Quote: ... amplifying the human fragment from GLP1R-tango (plasmid from Addgene, #66295, RRID:Addgene_66295), including the leader sequence present in the GLP1R-tango ...
-
bioRxiv - Neuroscience 2024Quote: ... amplifying the human fragment from GLP1R-tango (plasmid from Addgene, #66295, RRID:Addgene_66295), including the leader sequence present in the GLP1R-tango ...
-
bioRxiv - Biophysics 2024Quote: ... The human UBA1 and UBA7 genes were obtained from Addgene (34965, 12438). Subsequently ...
-
bioRxiv - Cell Biology 2024Quote: ... we inserted human LC3/GBRP cDNA in a pGEX-4T1 vector (RRID:Addgene_223726 ...
-
bioRxiv - Molecular Biology 2021Quote: A codon adapted version of human DUX4 (pCW57.1-DUX4-CA, Addgene plasmid #99281) was cloned into an inducible ...
-
bioRxiv - Cell Biology 2020Quote: pEGFP-LC3 (human) deposited by Toren Finkel lab was obtained from Addgene (# 24920)(Lee ...
-
bioRxiv - Cancer Biology 2021Quote: ... were generated by subcloning the respective human cDNA (from Addgene #100142 and #66350) into the MluI and BamHI sites] of the pLVX-Che-hi3 vector (a gift of Sanford Simon)78 ...