Labshake search
Citations for Addgene :
151 - 200 of 436 citations for GATOR2 complex protein WDR24 WDR24 Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: TIA1 proteins were expressed in the BL21DE3 bacterial cell line from the pET28b plasmid (Addgene) containing the Mus musculus (mouse ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.85 μg pVSV-G (Expresses VSV-G envelop protein for pseudotyping NanoMEDIC particle, Addgene #138479) (46) ...
-
bioRxiv - Developmental Biology 2024Quote: ... we utilized monomeric enhanced green fluorescent protein (mEGFP) (gift from Karel Svoboda, Addgene plasmid #18696) (Harvey ...
-
bioRxiv - Neuroscience 2024Quote: ... a red fluorescent calcium sensor protein (RCaMP) was amplified from pAAV.Syn.Flex.NES-jRGECO1a.WPRE.SV40 (Addgene cat#100853) using primers 5’-ACTAGTATGCTGCAGAACGAGCTTGC and ACCGGTCTACTAGTCTCAATTGTCACTTCGCTGTCATCATTTGT ...
-
bioRxiv - Biochemistry 2024Quote: ... The tag-free wildtype (Wuhan-hu-1) nucleocapsid protein plasmid was purchased from Addgene (#177937), and the plasmid encoding the Strep-tagged nucleocapsid protein was a kind gift from Dr ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... The dsRNA for Green fluorescent protein (GFP) was synthesised from plasmid pAC5.1B-EGFP (Addgene 21181) to be used as a negative control for off-target effects of dsRNA-mediated knockdown.
-
bioRxiv - Cell Biology 2024Quote: ... We purchased the plasmid expressing an ER-localized hook protein from Addgene (Ii-Str_Neomycin; #65308). To generate various model substates with artificial CAT-tails ...
-
bioRxiv - Cell Biology 2021Quote: ... Single-chain antibodies fused to GFP (scAB-GFP, Addgene #104998) were used for imaging translation sites through nascent polypeptide labeling ...
-
bioRxiv - Cell Biology 2020Quote: ... inhibitor of growth protein-2 (ING2) cDNA was a gift from Curtis Harris (Addgene plasmid # 13294) (Pedeux et al ...
-
bioRxiv - Molecular Biology 2020Quote: HeLa cells were infected with lentivirus carrying the Cas9-BFP (blue fluorescent protein) vector (Addgene 52962). HCT116 and HEK293T were transfected with the same vector using Lipofectamine 2000 (ThermoFisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: The majority of the constructs used for expressing aggregating proteins were obtained from Addgene (Watertown, MA). The Addgene catalog numbers are as follows ...
-
bioRxiv - Cancer Biology 2020Quote: ... A plasmid expressing Green Fluorescent Protein (GFP) (pLJM1-EGFP was a gift from David Sabatini (Addgene plasmid # 19319 ...
-
bioRxiv - Cancer Biology 2020Quote: HeLa cells were infected with lentivirus carrying the Cas9-BFP (blue fluorescent protein) vector (Addgene 52962). HCT116 were transfected with the same vector using Lipofectamine 2000 (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... The cDNA encoding EGFP-LC3 fusion protein was released from pBABE-EGFP-LC3-puro (Addgene, #22405) and cloned into pQCXIN-EGFP-N1-Neo by the 5’-EcoRI and 3’-AgeI sites ...
-
bioRxiv - Cell Biology 2021Quote: ... Corresponding oligonucleotides were annealed and cloned in the pX330 plasmid expressing human SpCas9 protein (Addgene #42230). The donor plasmids were constructed as follows ...
-
bioRxiv - Immunology 2023Quote: ... SARS-CoV-2 whole spike protein HexaPro was a gift from Jason McLellan (Addgene plasmid # 154754). SARS-CoV-2 HexaPro was expressed in Expi293F cells and purified with Ni-NTA resin followed by size exclusion as described previously [61] ...
-
bioRxiv - Biochemistry 2023Quote: Two vectors with C-terminal MBP (maltose-binding protein)-His6 Tag (2Cc-T; Addgene Plasmid #55209) or N-terminal His10-MBP Tag (2CT-10 ...
-
bioRxiv - Genomics 2022Quote: ... Protein A-MNase was expressed and purified from BL21(DE) carrying pET-pA-MN (Addgene: 86973).68–70
-
bioRxiv - Cancer Biology 2024Quote: ... cell lines were transiently transfected with a membrane-targeted fluorescent protein (glycosylphosphatidylinositol-anchored eGFP, Addgene #32601) using a TransIT-X2 transfection kit (Mirus) ...
-
bioRxiv - Cancer Biology 2024Quote: ... containing a C-terminus EGFP-tagged sequence of the full-length M237I p53 protein (Addgene, #11770), and 4 µL of Lipofectamine 2000 reagent ...
-
bioRxiv - Bioengineering 2023Quote: ... the protein coding sequence (CDS) of RLuc8.6 was amplified from pcDNA-RLuc8.6-53559 (Addgene ID 87125) and subcloned into the vector pRSETb115 (Addgene ID 89536 ...
-
bioRxiv - Systems Biology 2023Quote: Jurkat cells expressing dCas9-KRAB fusion protein were constructed by lentiviral delivery of pMH0006 (Addgene #135448) and FACS isolation of BFP-positive cells.
-
bioRxiv - Cell Biology 2023Quote: ... conjugated with the Rhotekin Rho Binding domain (RBD)-GST fusion protein (produced from Addgene plasmid #15247), for 1 hour at 4 °C ...
-
Comparative membrane proteomics reveals diverse cell regulators concentrated at the nuclear envelopebioRxiv - Cell Biology 2023Quote: ... All clones for lentiviral vectors expressing the proteins described in this study are available from Addgene.
-
bioRxiv - Bioengineering 2024Quote: ... The mCherry red fluorescent protein was taken from the pU6-pegRNA-GG-acceptor plasmid (Addgene #132777) via PCR using Q5 High-Fidelity DNA Polymerase (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... a solution containing two sgRNAs (40 ng/μL each) and Cas9 protein (250 ng/μL) (Addgene; 47327) (Gagnon et al. ...
-
bioRxiv - Biochemistry 2021Quote: The ORAI1-yellow fluorescent protein (YFP) construct was purchased from Addgene (Cambridge, MA, USA; plasmid no. 19756). Site directed mutagenesis using the Pfu Turbo DNA polymerase from Agilent Technologies (Santa Clara ...
-
bioRxiv - Microbiology 2022Quote: ... with the exception that a 1872 bp region of pLifeAct_mScarlet-i_N1 (Bindels et al., 2017) (26.4 kDa LifeAct-mScarlet protein, Addgene) encompassing the CMV enhancer element ...
-
bioRxiv - Neuroscience 2020Quote: ... The control transmembrane protein PVRL3α was cloned into the mammalian expression vector pCAG-mGFP (Addgene, Cat#14757) to express the protein under the pCAG promoter (pCAG-PVRL3α) ...
-
bioRxiv - Cell Biology 2021Quote: ... hLamp1-BFP (#1016) plasmid encoding BFP-labeled version of human Lamp1 protein was from Addgene (Cat# 98828). GFP-hRab14.dn3 (#1017) ...
-
bioRxiv - Biochemistry 2021Quote: ... Affinity precipitation of other RASSF proteins was done as above for RASSF5 using plasmids provided by Addgene RAS clone collection (RASSF1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... with a modification to include the 717 bp coding sequence for the EGFP protein (Addgene plasmid 26123). The number of genes captured and percentage transcripts of mitochondrial origin ...
-
bioRxiv - Neuroscience 2021Quote: ... retrograde AAV expressing enhanced blue fluorescent protein (EBFP) and Cre recombinase (AAVrg-pmSyn1-EBFP-cre, Addgene #51507) was injected into either NAc or RSC of Rosa26TdTomatoAi9 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and the vectors encoding for the packaging proteins (pCMVR8.74; gift from Didier Trono (Addgene plasmid # 22036; http://n2t.net/addgene:22036; RRID:Addgene_22036)) and VSV-G envelope (pMD2.G ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmids encoding HCoV-229E and SARS-CoV-2 N proteins were obtained from Addgene (#151912 and #141391). C-terminally FLAG-tagged 229E N and SARS-CoV-2 N constructs were cloned into pcDNA3.1 using specific primer sequences (Supplementary Table S1).
-
bioRxiv - Bioengineering 2023Quote: ... ssDNA binding protein and peptide sequences were synthesized and assembled into an AIO plasmid modified from Addgene plasmid #42230 by golden gate cloning ...
-
bioRxiv - Immunology 2023Quote: ... 0.5 µg of a plasmid encoding the vesicular stomatitis virus G protein (pMD2.G, Addgene plasmid #12259), 0.25 µg of a plasmid encoding for the transactivating protein Rev (pRSV-Rev ...
-
bioRxiv - Physiology 2022Quote: ... The pTwist-EF1a carrying the SARS-CoV-2 E protein with 2xSTREP tags were obtained from Addgene. pCMV-rpHluorin-N1 was a kind gift from Dr ...
-
bioRxiv - Biochemistry 2024Quote: ... Cells were co-transfected with plasmids encoding a mixture of viral packaging proteins VSV-G (12259, Addgene), viral backbone psPAX2 plasimd (12260 ...
-
bioRxiv - Microbiology 2024Quote: ... envelope protein-expressing vector pCMV-VSVG (38) and the transfer vectors pEF1a-CAS9-2A-Blasticidin (#52962, Addgene) or pU6-gRNA-PGK-Puro-2A-BFP encoding CRISPR-Cas9 guide RNAs (gRNAs ...
-
bioRxiv - Molecular Biology 2023Quote: ... fragments containing promoter and fusion protein segments were digested and cloned into the pKHR4 vector (Addgene #74592) using SpeI (NEB #R3133 ...
-
bioRxiv - Genetics 2024Quote: ... and blue fluorescent protein (tagBFP) with a KRAB domain at the C-terminus (Addgene 167981; Figure 1A)14 ...
-
bioRxiv - Immunology 2024Quote: pcDNA3.1 plasmids encoding the C9-tagged SARS-CoV-2 S protein (pcDNA3.1-SARS2-S) (Addgene plasmid # 145032)62 ...
-
bioRxiv - Developmental Biology 2024Quote: ... mEos3.2 and green-to-red photoconvertible protein (a gift from Michael Davidson & Tao Xu (Addgene plasmid 54525) was coupled to Histone 2B (H2B ...
-
bioRxiv - Biochemistry 2024Quote: ... The plasmid used to produce the nanodiscs scaffold protein (MSP1E3D1) was purchased from Addgene (Cambridge, MA, USA).
-
bioRxiv - Biochemistry 2024Quote: Human interferon-induced protein with tetratricopeptide repeats 1 (IFIT1) gene (Gene ID: 3434) was obtained from Addgene in the plasmid vector pET28a_IFIT1 ...
-
bioRxiv - Biochemistry 2024Quote: ... bearing the gene for membrane scaffold protein expression was a gift from Stephen Sligar (Addgene plasmid # 20066) and was expressed as described before43 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... human TP53 (tumor protein 53, p53) was amplified from plasmid pLenti6 / V5-p53_wt p53 [bought from Addgene, catalog number #22945] ...
-
bioRxiv - Physiology 2024Quote: ... pcDNA3-EGFP encoding for an enhanced green fluorescent protein (Addgene plasmid #13031; http://n2t.net/addgene:13031; RRID:Addgene_13031); Lyn-R-GECO1 (gift from Won Do Heo (Addgene plasmid # 120410 ...
-
bioRxiv - Bioengineering 2024Quote: ... the MS2 coat protein (MCP) (N55K variant) ORF was PCR amplified from MS2-P65-HSF1_GFP (Addgene, 61423)74 and inserted with a serine-glycine linker via Gibson Assembly into pLV_CAG_Gag at the C-terminus of MLV Gag in order to generate the plasmid pLV_CAG_Gag-MCP ...