Labshake search
Citations for Addgene :
151 - 200 of 2816 citations for 7 PHENYL 1 2 4 TRIAZOLO 1 5 A PYRIMIDINE 6 CARBONITRILE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2020Quote: ... pmTagBFP2-Lifeact-7 (Addgene plasmid #54602) from M ...
-
bioRxiv - Cell Biology 2022Quote: ... mTagRFP-T2-Mito-7 (Addgene #58041) (referred to as mitoRFP in the text) ...
-
bioRxiv - Microbiology 2021Quote: ... 4-363h21C1 and 3-978h1C1 and were cloned into lentiviral vector pLKO.1-puro (Addgene, catalogue #8543). Lentiviral vectors were produced in 293T cells by Fugene transfection and the supernatant was used to infect Jurkat cells ...
-
bioRxiv - Neuroscience 2023Quote: 1-4 evenly spaced ∼60 nl injections of the AAV1-synapsin-l-GCamp6f (Addgene, MA stock #100837) that had been diluted to a titer of ∼1×10^12 vg/mL using sterile PBS were made in each cranial window ...
-
bioRxiv - Immunology 2021Quote: ... HEK293T cells were seeded in 6-well plates and the next day transfected with 1 μg psPAX2 packaging plasmid (Addgene 12260), 500 ng pMD2.G VSV-G envelope plasmid (Addgene 12259 ...
-
bioRxiv - Cancer Biology 2020Quote: ... sgRNAs against Luciferase (Luc)(5’-CCCGGCGCCATTCTATCCGC-3’) and USF2 (#2, #3 and #5 as above) were cloned into mCherry-expressing LRCherry2.1 (Addgene #108099) vector.
-
bioRxiv - Neuroscience 2020Quote: Stereotaxic injection of AAV-EF1a-DIO-HChR2(H134R)-eYFP (serotype 2/1 or 2/9, U. Penn Vector Core, Philadelphia, PA, USA or Addgene, Watertown, MA, USA) was performed in 6-8 weeks old DAT-IRES-Cre or FoxP2-Cre transgenic mice ...
-
bioRxiv - Neuroscience 2020Quote: A subsample of rats (n = 4, 2 males and 2 females) received bilateral retrograde AAV-CAG-TdTomato (59462-AAVrg; Addgene, MA) in mPFC (PL/IL ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV9-hSyn- GrabDA1h (n = 5 Area X hemispheres; n = 2 MST hemispheres; Addgene), AAV5-CAG- Dlight1.1 (n = 1 Area X hemisphere ...
-
bioRxiv - Neuroscience 2021Quote: ... 1 μl of AAV2/5-GfaABC1D-Lck-GCaMP6f (1013 genome copies/ml) (Addgene viral prep # 52924-AAV5) was injected into the DLS ...
-
bioRxiv - Neuroscience 2020Quote: ... pAAV.Syn.Flex.GCaMP6f.WPRE.SV40 virus (500 nL, titer ≥ 1X1013 vg/mL, working dilution 1:5, Addgene, #100833-AAV9; https://www.addgene.org/100833/RRID:Addgene_100833) was injected unilaterally into the DS (L = ±1.5 ...
-
bioRxiv - Physiology 2023Quote: ... pAAV-GfaACC1D.Lck-GCaMP6f.SV40 (1.53×1013 vg/ml, working dilution 1:5, Addgene plasmid #52925-AAV5; http://www.addgene.org/52295/; RRID: Addgene_52925) was a gift of Baljit Khak ...
-
bioRxiv - Synthetic Biology 2022Quote: ... we have cloned their respective oligonucleotides in following vectors: PDX1 in pX330A-1×5 (Plasmid #58769, Addgene), NKX6.1 in pX330S-2 (Plasmid #58778 ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 µL of the adeno-associated viral vector rAAV9/1.EF1a.DIO.hChR2(H134R)-eYFP.WPRE.hGH (Addgene, #20298-AAV9) was dyed with 0.3 µL fast green (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... and AAV.Syn.NES-jRGECO1a.WPRE.SV40 (Serotype 2/9; titer ≥ 1×1013 vg/mL) viruses were purchased from Addgene.
-
bioRxiv - Immunology 2021Quote: ... Guide 1 (TGTTGGGGAACATATGACAC) and Guide 2 (AAGGAAAAATTCAAACAAGG) sequences were cloned into lentiGuide-puro plasmid (Addgene, #52963), transformed in Stbl3 bacteria (Invitrogen ...
-
bioRxiv - Genetics 2023Quote: pHarvester was generated using pCFD5-gRNA#1&2 and pnos-Cas9-nos plasmids (Addgene no: 62208). Briefly ...
-
bioRxiv - Neuroscience 2023Quote: Heterozygous ChAT-Cre mice were bilaterally injected with 1.0 µL of pAAV.Syn.Flex.GCaMP6s.WPRE.SV40 (diluted 1:2 in dPBS; Addgene: 100845-AAV5) in basal forebrain (AP ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 µL of the adeno-associated viral vector rAAV9/1.EF1a.DIO.hChR2(H134R)-eYFP.WPRE.hGH (Addgene, #20298-AAV9) was dyed with 0.3 µL fast green (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2020Quote: EKVX cells (4×105) were plated in 6-well plates and were transfected with 3μg of linearized lentiCas9-Blast (Addgene, 52962) using lipofectamine 2000 (11-668-019 ...
-
bioRxiv - Cell Biology 2020Quote: ... HEK293T cells were transfected using calcium phosphate method with 4-6 µg plasmid DNA and 8 µg of each pMD2.G and psPAX2 (Addgene). After 48 h ...
-
bioRxiv - Molecular Biology 2024Quote: The HTLV-1 CA (Gag amino acids 132-349) was cloned into the 6×His SUMO bacterial expression plasmid (pHYRSF53, Addgene, Watertown, MA), with mutants created by using the Gibson assembly procedure ...
-
bioRxiv - Cell Biology 2020Quote: ... and pT7-7 α-Syn A53T (Addgene plasmid #10572737 ...
-
bioRxiv - Cell Biology 2021Quote: ... The plasmid mEGFP- lifeact-7 (Addgene # 54610) was a gift from Michael Davidson and Lamp1-mGFP (Addgene # 34831 ...
-
bioRxiv - Cell Biology 2021Quote: ... and mRuby-LifeAct-7 (Addgene plasmid #54560) were gifted by Michael Davidson ...
-
bioRxiv - Cell Biology 2021Quote: ... 7 and 8 were ordered from Addgene. The plasmids ordered were HDAC2 Flag (Addgene plasmid # 36829 ...
-
bioRxiv - Cell Biology 2021Quote: ... and td-Tomato-LifeAct 7 (Addgene 54528).
-
bioRxiv - Microbiology 2021Quote: ... and mRuby-LifeAct-7 (Addgene plasmid#54560) were gifted by Michael Davidson ...
-
bioRxiv - Microbiology 2022Quote: ... 7 μg of pMD2.G (Addgene # 12259), and 11 μg of pMDLg/pRRE (Addgene # 12251 ...
-
bioRxiv - Cell Biology 2023Quote: ... and mTagBFP2-Lifeact-7 (Addgene plasmid #54602)69 from Dr ...
-
bioRxiv - Cancer Biology 2019Quote: ... Pfeiffer CRISPRi cells (2×108) were transduced with the top 5 half library of hCRISPRi_v2 (Addgene #83969, i.e. 5 sgRNAs per gene) at an MOI of 0.3 in 200 mL culture medium + 8 μg/mL polybrene in 2× 225 cm2 cell culture flasks ...
-
bioRxiv - Microbiology 2024Quote: The viral 5′UTR reporter constructs were synthesized using GeneArt and cloned into pLV-SARS-CoV-2 5′UTR-Luciferase (Addgene Cat#191480)32 using NdeI and BsaBI ...
-
bioRxiv - Cell Biology 2022Quote: ... and pLKO.6 sfCherry were generated from pLKO.1 puro plasmid (Addgene plasmid # 8453; http://n2t.net/addgene:8453; RRID:Addgene_8453; a gift from Bob Weinberg) (Stewart et al. ...
-
bioRxiv - Immunology 2021Quote: ... Platinum-E cells were transfected at 70-80% confluency on 10 cm plates with 4 μg pCL-Eco(40) and 6 μg of either pMSCV-pBabeMCS-IRES-RFP (Addgene; 33337) or pMSCV-Myc-IRES-RFP (Addgene ...
-
bioRxiv - Neuroscience 2021Quote: ... working dilution 1:5) was a gift from Douglas Kim (Addgene viral prep #100833-AAV9; http://n2t.net/addgene:100833; RRID:Addgene_100833). pAAV5-hSyn-dLigh1.2 (titer ≥ 4×1012 vg/ml ...
-
bioRxiv - Cell Biology 2020Quote: ... was generated by ligating oligonucleotides containing the targeting sequence 5’-CAGTTCCTGGGTGGAGCTA-3’ into pLKO.1-puro (Addgene # 8453). The mitochondrial (CMV-mitoCAR-GECO1 ...
-
bioRxiv - Neuroscience 2023Quote: ... Suppl Fig 3: AAV9-CaMKIIa-hChR2-EYFP (1:5, Addgene viral prep #26969- AAV9; http://n2t.net.addgene:26969; RRID; Addgene:26969 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sequences (shPROX1-1: TGCTGTTGACAGTGAGCGCGAGGACCAAGATGTCATCTCATAGTGAAGCCACAGATGTATGAGATGAC ATCTTGGTCCTCATGCCTACTGCCTCGGA; shPROX1-2: TGCTGTTGACAGTGAGCGCCCCCGAGAAAGTTAC AGAGAATAGTGAAGCCACAGATGTATTCTCTGTAACTTTCTCGGGGATGCCTACTGCCTCGGA) were cloned into the LT3GEPIR backbone100 (Addgene; 111177) and used to generate lentiviral particles to transduce into organoids as described99 ...
-
bioRxiv - Cancer Biology 2023Quote: ... A CRISPR/dCas9 vector was constructed as follows: pX330A_dCas9-1×2 (Addgene, Watertown, MA; plasmid ID 63596) (20 ...
-
bioRxiv - Plant Biology 2023Quote: ... fw2.2-sgRNA-1 and fw2.2-sgRNA-2 were fused to the Arabidopsis AtU6-26 promoter (Addgene #46968) by digestion-ligation reaction in plCH47751 (Addgene #48002 ...
-
bioRxiv - Molecular Biology 2021Quote: ... a region bearing six let-7 binding sites was PCR-amplified from MSCV puro let-7 sponge (Addgene #29766) and cloned between AgeI and EcoRI sites downstream of GFP.
-
bioRxiv - Cell Biology 2024Quote: ... and an mEGFP plasmid with 1 kb homology arms (AICSDP-4:TUBA1B-mEGFP, Allen Institute, Addgene plasmid # 87421; RRID:Addgene_87421)41 mutated for the gRNA binding site ...
-
bioRxiv - Neuroscience 2023Quote: ... mixed 1:1 with pAAV.CAMKII.Cre.SV40 (#105558; Addgene), or pAAV.CAG.GFPsm-myc.WPRE.SV40 (#98926 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lentiviral particles were generated by transfecting HEK 293T cells with 12 μg of pLJM1-mEGFP or pLJM1ALKBH5 plasmids with 6 μg of psPAX2 packaging plasmid and 2 μg of pMD2.G envelope plasmid (Addgene). The medium was replaced 16h after transfection ...
-
bioRxiv - Cell Biology 2020Quote: ... and transfected at 4-6 h with a plasmid encoding HA-Separase (pCS2+HA-hSeparase was a gift from Marc Kirschner, Addgene plasmid # 33018), Plk1TD expression was induced 8-10 h after shake off and cells were fixed at 28 h to analyze distancing or at 32 h (20 h of S phase arrest ...
-
bioRxiv - Cell Biology 2022Quote: ... and mEmerald-Nucleus-7 (Addgene plasmid no. 54206) were gifts from Michael Davidson (Florida State University) ...
-
bioRxiv - Biophysics 2019Quote: ... plasmid EGFP-Actin-7 from Addgene (ref 56421) was used with the electroporation program Amaxa T20.
-
bioRxiv - Cell Biology 2020Quote: ... and to link GFP11×7 tag (from Addgene Plasmid #70224 ...
-
bioRxiv - Cancer Biology 2020Quote: ... with lentiviral packaging vectors psPAX2 (7 μg; Addgene) and pMD2.G (3,5 μg ...
-
bioRxiv - Neuroscience 2021Quote: ... 7 μg Cas9 nuclease plasmid (pX459, Addgene #62988) 1.4 μg pPN298 and 1.4 μg pPN306 were electroporated into 2.5×106 cells at 1050V ...