Labshake search
Citations for Addgene :
151 - 200 of 3466 citations for 7 Chloro 1 3 dihydro imidazo 4 5 c pyridin 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... The HK2-targeting sequence 5’-CCGGCCAGAAGACATTAGAGCATCTCTCGAGAGATGCTCTAATGTCTTCTGGTTTTTT-3’ was cloned in the pLKO.1 hygro vector (a gift from Bob Weinberg; Addgene plasmid #24150). HK2 expression in Huh7-GCK+/HK2+ and Huh7-GCK+/HK2−Sh was analyzed on cell lysates by western blotting (Supplementary Fig ...
-
bioRxiv - Synthetic Biology 2019Quote: We first obtained the yeast strain containing the reporter gene by integrating (lexA-box)x-PminCYC1-Citrine-TCYC1 plasmids (x = 4, 2 or 1) (Addgene plasmids #58434 ...
-
bioRxiv - Immunology 2021Quote: ... were co-electroporated with 5 µg of either pCB92-C*05 or pEx-CAG-KIR2DL1 and 5 µg of pPhiC31o (Addgene) using the Neon transfection system (Thermo Fisher ...
-
bioRxiv - Developmental Biology 2020Quote: ... a sgRNA targeting the 3’ end of Spen ORF (5’-GATTGTCATTGCCTCGGTG-3’) was cloned in the Cas9-PuroR pX459 vector (Addgene plasmid #62988). The donor template was made using a gblock from Integrated DNA Technologies coding for compatible 5’ and 3’ HA of 600 bp with a NheI and AscI restrictions sites in-between the 5’ and 3’ HA ...
-
bioRxiv - Cancer Biology 2020Quote: ... tag-containing MAP3K7 forward primer (5’-cagtGGGCCCaccATGTA CCCATACGATGTTCCAGATTACGCTAGCGGCCGCATGTCTACAGCCTCTGCCG-3’) and its reverse primer (5’-ATAggatccTCATGAAGTGCCTTGTCGTTTC-3’) were used to amplify MAP3K7 from pDONR223-MAP3K7 plasmid (Addgene plasmid #23693) and cloned into the NotI and BamHI sites of lentiviral vector pHIV-Zsgreen (Addgene plasmid #18121 ...
-
bioRxiv - Cell Biology 2020Quote: ... 5’- CGCGTCGACATGGTGAGCAAGGGCGAGGA-3’ and mCh REV: 5’-ACGCGGATCCCTTGTACAGCTCGTCCATGC-3’ and ligating it into pENTR4 no ccDB (gift from E. Campeau, Addgene plasmid #17424) plasmid (Campeau ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5’-GCGCCTCCTGCGAAGCCATCAGG-3’ and 5’-CGTAGCGGGAAGGGTCAAGAGGG-3’) were similarly cloned into the lentiCRISPRv2-hygro vector (a gift from Brett Stringer, Addgene plasmid #98291)51.
-
bioRxiv - Genomics 2024Quote: ... 5’CTTCG-AATAGAATCGCCGCCCGCT3’;antisense:3’CTTATCTTAGCGGCGGGCGACAAA5’)and(se nse:5’CTTC-GTTGTGGCTGCACAGACTGG3’;antisense:3’CAACACCGACGTGTCTGACC-CAAA5’) into the pU6-BbsI-chiRNA plasmid (Addgene no. 45946), following the protocol outlined on the flyCRISPR website ...
-
bioRxiv - Microbiology 2019Quote: ... Plasmids mIFP12-Rab4a-7 (#56261) and mIFP-Golgi-7 (#56221) were purchased from Addgene.
-
bioRxiv - Neuroscience 2023Quote: ... we generated small guide RNAs to PAM sites in proximity to exons 4 and 7 of the murine Grik3 locus and cloned these into the pSpCas9(BB)-2A-GFP (PX458) backbone (Addgene #48138), where expression of the sgRNAs is controlled under the U6 promoter ...
-
bioRxiv - Cell Biology 2023Quote: ... AICSDP-7:SEC61B-mEGFP (Addgene plasmid # 87426 ...
-
bioRxiv - Molecular Biology 2021Quote: ... a DNA fragment containing 5′-AGCCATGGGAAACATCGCAC-3′ was cloned into pL-CRISPR.EFS.tRFP (Addgene#57819) (Heckl et al. ...
-
bioRxiv - Genetics 2020Quote: ... Gal4 5’ and 3’ homology arms were PCR-amplified using pDEST-APIGH (Addgene # 112804) as the template ...
-
bioRxiv - Cancer Biology 2021Quote: The Rb1 CRISPR plasmid with gRNA sequence 5-GCTCTGGGTCCTCCTCAGGA-3 (TLCV2-RB1, Addgene#87836) was purchased from Addgene ...
-
MEK inhibitor resistance in lung cancer cells associated with addiction to sustained ERK suppressionbioRxiv - Cancer Biology 2022Quote: The sgRNA sequence for RB1 (5’-GCTCTGGGTCCTCCTCAGGA-3’) was cloned into lentiCRISPRv2 (Addgene #52961) plasmid and the co-transfected with psPAX2 (Addgene #12260 ...
-
bioRxiv - Molecular Biology 2021Quote: ... laevis b-globin 5′- and 3′-UTR sequences were obtained from pT7TS (Addgene #17091). Mouse Malat1 3′ sequence was obtained from the Comp.25 mutant plasmid (Wilusz et al. ...
-
bioRxiv - Cancer Biology 2019Quote: CXCR4 shRNA Sequence: 5’CCGGTCCTGTCCTGCTATTGCATTACTCGAGTAATGCAATAGCAGGACAGGATTTTTG 3’ was cloned into the 3rd generation transfer plasmid pLKO.1 TRC cloning vector (Addgene cat no. 10878) between unique AgeI and EcoRI sites downstream of the U6 promoter ...
-
bioRxiv - Cancer Biology 2020Quote: OE19-dCas9-KRAB stable cells were generated by transfecting 1×106 OE19 cells with 7.5 μg Cas9 plasmid with guides targeting the AAVS1 locus (Addgene #42230; 5’-GGGGCCACTAGGGACAGGAT-3’) and 7.5 μg donor plasmid (pAAVS1-Puro-DNR ...
-
bioRxiv - Molecular Biology 2022Quote: ... and g2 (5’- CCATGTATGGGGTCACAGCCTCTGCTAGGACCAAGCCAAGACCATCTGCTGTCACAACCACTGC ACACCTGG-3’) and cloned these guides into the All-in-one (AIO)-PURO vector encoding the Cas9D10A nickase (Addgene #74630). U2OS cells were treated with 2 µg/mL of puromycin (Invitrogen ...
-
bioRxiv - Developmental Biology 2023Quote: ... lentiviral supernatants were generated by transfecting one 10-cm plate of HEK-293T cells at 90% confluency with 3 µg pMD2.G (Addgene #12259), 9 µg psPAX2 (Addgene #12260) ...
-
bioRxiv - Bioengineering 2022Quote: ... we generated one plasmid harboring 4 distinct sgRNAs targeting the promoter region of AaRel1 (AAEL007696, OA-1127B, Addgene plasmid #190997). Firstly ...
-
bioRxiv - Neuroscience 2022Quote: ... (4) P10-3’UTR was amplified from pJFRC81-10XUAS-IVS-Syn21-GFP-p10 (Addgene 36432); (5 ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2×106 mEF-depleted cells were transfected with sgRNAs 2+3 and pCas9_GFP (a gift from Kiran Musunuru, Addgene #44719). To generate Chaserrb/b mESCs ...
-
bioRxiv - Cancer Biology 2019Quote: ... A mixture of 3 transfection plasmids were produced by combining 2 µg pMDG.2 (Addgene #12259) (Addgene, Watertown, Massachusetts, USA); 4 µg of pCMV delta R8.2 (Addgene #12263 ...
-
bioRxiv - Biophysics 2021Quote: The wild type SARS-CoV-2 S HexaPro expression plasmid was a gift from Jason McLellan (7) and obtained from Addgene (plasmid #154754 ...
-
bioRxiv - Cell Biology 2023Quote: ... KIF5C(1-560)-2xmCh-EF(C) (Addgene #61664) and KIF5C(1-560)-mCit (Addgene #61676 ...
-
bioRxiv - Biochemistry 2021Quote: ... elegans ERH-2 (NCBI gene ID: 185323) was cloned into pET28a (Addgene: 69864-3), containing an N-terminal His6 tag followed by a TEV protease cleavage site (MGSSHHHHHHSSGENLYFQGHMAS ...
-
bioRxiv - Genomics 2019Quote: ... Each sequence was then transferred to the pMW#2 and pMW#3 vectors (Addgene) using the LR Clonase II (ThermoFisher) ...
-
bioRxiv - Neuroscience 2024Quote: ... postnatal 2-3 months) were injected bilaterally with pAAV-CaMKIIa-hM4D(Gi)-mCherry (Addgene: AAV8 ...
-
bioRxiv - Cell Biology 2022Quote: ... gRNA (5’ - TTACTGCTCATCCTTGTCCT-3’) was cloned into pCFD5 vector (Port et al., 2014) (Addgene #73914) and then the resulting vector was injected into attP2 site (BDSC #25710) ...
-
bioRxiv - Pathology 2019Quote: ... gRNA_ex93.0: 5’-GCGTGAGGACAACCGCGTGCAGG-3’) were cloned into the pSPCas9(BB)-2A-GFP plasmid (Addgene 48138) and introduced into CRL1502 iPSCs by reverse transfection using TransIT-LT1 (Mirus Bio) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Rev 5’-AAAGCTAGCTCAGGTTGCCTGGTCCAG-3’ and cloned into the pCI H2B-RFP vector (Addgene plasmid #92398). For CRISPR/Cas9 targeting ...
-
bioRxiv - Cell Biology 2023Quote: ... the gRNA sequence 5’-AATGAGGCCTTGGAACTCA-3 was cloned into the Px330 vector (Addgene plasmid #42230) and transfected into cells using Lipofectamine Stem according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... and a non-targeting control (5’-CACCGGTATAATACACCGCGCTAC-3’) were cloned into the lentiCRISPRv2 vector (Addgene). The gRNA construct was then co-transfected with two packaging plasmids (pMD2.G and pSPAX2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... SgRNA targeting EGFR (5’-CGATCTCCACATCCTGCCGG-3’) was cloned into the lentiGuide-puro vector (Addgene, USA) (18) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5′-GGCTGCCGTAGCGCGACGTG-3′) were cloned into pLentiCRISPRv2 (Addgene-52961). An NT gRNA (5′-GTATTACTGATATTGGTGGG-3′ ...
-
bioRxiv - Molecular Biology 2020Quote: ... The two configurations that enabled efficient packaging of full-length vector genomes (designs 1 and 4) are available on Addgene (pEJS1099: Dual-sgRNA:Design 4, Addgene #159537; pEJS1096: Dual-sgRNA:Design 1, Addgene # 159538). Oligonucleotides with spacer sequences for target genes were inserted into the sgRNA cassette by ligation into the BspQI and BsmBI cloning sites.
-
bioRxiv - Cell Biology 2019Quote: mPlum-Lifeact-7 (Addgene plasmid # 54679) and mCherry-Sec61 β (Addgene plasmid # 49155 ...
-
bioRxiv - Neuroscience 2020Quote: ... or mCherry-Mito-7 (Addgene #55102) (34 ...
-
bioRxiv - Neuroscience 2021Quote: The plasmid pT7-7 (Addgene 36046)[29] coding for the human α-synuclein wild type (α-syn ...
-
bioRxiv - Synthetic Biology 2020Quote: ... pmTagBFP2-Lifeact-7 (Addgene plasmid #54602) from M ...
-
bioRxiv - Cell Biology 2022Quote: ... mTagRFP-T2-Mito-7 (Addgene #58041) (referred to as mitoRFP in the text) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purified ULP1 protease was added to the eluent overnight at 4°C (pFGET19_Ulp1, Addgene, Watertown, MA). The cleaved product was loaded onto a Ni column (Cytvia HisTrap™ High Performance ...
-
bioRxiv - Genetics 2022Quote: ... were cloned into pCFD4-U6:1-U6:3 (Addgene® plasmid #49411 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... encoding the Luc mRNA with the SARS-CoV-2 packaging signal in 3’-UTR (Addgene), were co-transfected with plasmids expressing the SARS-CoV-2 nucleocapsid (nCoV-2-N) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Optimal gRNA (5’-CCTACGAACTCCGGTGTCAG-3’) was cloned into the pSPCas9(BB)-2A-GFP plasmid (Addgene #48138) as described previously by Ran et al.,21 and introduced into ciPTEC using PolyPlus JetPrime ...
-
bioRxiv - Cell Biology 2021Quote: ... Reverse primer NT: 5’-CGGGATCCCTATTGAGTTCTTTTGTGCTC-3’) and cloned into the mApple-C1 vector (Addgene plasmid # 54631) using the XhoI and BamHI restriction sites ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Optimal gRNA (5’-GTCGTAAAGCTGGAGAACGG-3’) was cloned into the pSPCas9(BB)-2A-GFP plasmid (Addgene #48138) as described previously by Ran et al ...
-
bioRxiv - Genomics 2021Quote: ... 5 µg of sgRNA plasmid library was co-transfected with 3 µg of psPAX (Addgene, 12260) and 1 µg of pMD2.G (Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: ... compact BFP-tagged CRISPRi sublibraries containing 5 sgRNAs per TSS (Addgene, Cat#83971-3 and #83975) expressed in the pCRISPRi-v2 expression vector (Addgene ...