Labshake search
Citations for Addgene :
151 - 200 of 1569 citations for 7 BROMOQUINOLINE 2 3 DICARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... The 3-nitro-tyrosine incorporation plasmid (pAcBac1-3-nitroTyr-A7, Addgene # 141173) was as previously described.35
-
bioRxiv - Cell Biology 2021Quote: ... 3 μg psPAX2 (Addgene), and 3 μg pMD2.G (Addgene ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 (Addgene plasmid #96963)92 ...
-
bioRxiv - Microbiology 2021Quote: ... The coding sequence from amino acid 747E to 1061K was amplified by PCR from the pDONR207 SARS-CoV-2 NSP3 plasmid (Addgene, #141257, a gift from Fritz Roth[32]), including a Kozak sequence and ATG start codon in the forward primer and a TAA stop codon in the reverse primer (PLPcd_Fw ...
-
bioRxiv - Cancer Biology 2022Quote: ... Oligos 5’ CACCGATCACCCTCTTCGTCGCTT 3’ / 5’ AAACAAGCGACGAAGAGGGTGATC 3’ and 5’ CACCGCTTAGGCCGGAGCGAGCCT 3’/ 5’ AAACAGGCTCGCTCCGGCCTAAGC 3’ were annealed and cloned into the px458 cut with BsaI (Addgene #48138). Plasmids were transfected into cell lines using Genejuice transfection reagent (Merck ...
-
bioRxiv - Immunology 2022Quote: ... a 3’ LTR-restored lentiviral expression vector (Addgene #101337, hereafter LV-3’LTR) expressing a GFP reporter was used to express ACE2 or CD169 ...
-
bioRxiv - Cell Biology 2023Quote: ... Most of the genes related with 14-3-3 were acquired from Addgene and cloned into pMX plasmids ...
-
bioRxiv - Developmental Biology 2020Quote: ... targeting the 5’ (5’-AGTGCGCTTCGTCACTGCAC-3’) and 3’ (5’-TCCTCCCGCCCCGACGCGGA-3’) region of the Spen ORF were cloned in the Cas9-GFP pX458 vector (Addgene plasmid #48138). Compatible 5’ and 3’ Homology arms (HA ...
-
bioRxiv - Cell Biology 2019Quote: ... mCherry-Golgi-7 was a gift from Michael Davidson (Addgene plasmid: no. 55052) and the cassette was subcloned into a pCSIIbsr vector ...
-
bioRxiv - Cell Biology 2021Quote: Mito-Emerald (mEmerald-Mito-7) was a gift from Michael Davidson (Addgene #54160) 43 ...
-
bioRxiv - Biochemistry 2022Quote: pT7-7 WT α-syn construct (Addgene, USA, gifted from Hilal Lashuel [34]), was transformed into BL21-Gold (DE3 ...
-
bioRxiv - Cell Biology 2019Quote: ... The plasmid mAzurite-Actin-7 (a gift from Michael Davidson Addgene plasmid 55227) was modified by incorporating the M2×24 array with 5’ XbaI and 3’ BclI sites ...
-
bioRxiv - Cancer Biology 2019Quote: mTagRFP-T-Fibrillarin-7 was a gift from Michael Davidson (Addgene plasmid # 58016); GFP-Nucleolin from Michael Kastan (Addgene plasmid # 28176 ...
-
bioRxiv - Physiology 2022Quote: ... cells were transfected with 1μg DsRed2-Mito-7 (Mito-dsRed) (Addgene Plasmid #55838) by lipofectamine (Invitrogen L3000008 ...
-
bioRxiv - Cell Biology 2023Quote: ... Soluble mCherry (pmCherry-N3 plasmid) was cloned from pmCherry-mito-7 (Addgene #55102).
-
bioRxiv - Cell Biology 2024Quote: ... gene targeting sgRNAs (Supp Table 7) were cloned into pX459 (Addgene plasmid #48139) using BbsI (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... 5′-CAAACAATCAGCAATGCCTG-3′ and 5′-TGAAGTATTCAGAACAGAAG-3′ and cloned into pX330-P2A-EGFP (Addgene) through ligation using T4 ligase (New England Biolabs) ...
-
bioRxiv - Cell Biology 2020Quote: ... and pET28a(+) (Addgene #69864-3), for His6-tag protein purification ...
-
bioRxiv - Systems Biology 2023Quote: ... and pMW#3 (Addgene #13350) destination vectors using LR Clonase (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2023Quote: - vector pGEX-4T-3 (Addgene_79149) to express only GST protein for alternative screening.
-
bioRxiv - Systems Biology 2024Quote: ... and pMW#3 (Addgene #13350) destination vectors using LR Clonase (ThermoFisher #11791100) ...
-
bioRxiv - Cell Biology 2020Quote: ... and pT7-7 α-Syn A53T (Addgene plasmid #10572737; http://n2t.net/addgene:105727; RRID:Addgene_105727) (gift from Hilal Lashuel).
-
bioRxiv - Neuroscience 2022Quote: ... we injected AAV1-CAG-FLEXFRT-ChR2(H134R)-mCherry (75470, 7×1012 vg/mL, Addgene). For imaging DA dynamics ...
-
bioRxiv - Biophysics 2022Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid 54920 ...
-
bioRxiv - Cell Biology 2019Quote: ... mEmerald-Vimentin-7 and F-tractin-EGFP were gifts from Michael Davidson (Addgene; 54299) and Dr ...
-
bioRxiv - Biophysics 2022Quote: ... mApple-Lifeact-7 (denoted Lifeact-mApple here) was a gift from Michael Davidson (Addgene plasmid # 54747 ...
-
bioRxiv - Developmental Biology 2019Quote: ... Nslmb-vhhGFP4 coding sequence was amplified from pcDNA3-NSlmb-vhhGFP4 (Addgene plasmid #35579, (7)) by PCR and cloned into pCS2+ plasmid by Gibson assembly.
-
bioRxiv - Cell Biology 2020Quote: Plasmids for the expression of recombinant α-Syn were: pT7-7 α-Syn (Addgene plasmid #3604636 ...
-
bioRxiv - Biophysics 2020Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid # 54920 ...
-
bioRxiv - Neuroscience 2021Quote: ... or AAV5-hSyn-eGFP (titer ≥ 7×1012 vg/mL; Addgene viral prep #50465-AAV5) as control ...
-
bioRxiv - Microbiology 2022Quote: Several plasmids were a kind gift from Nevan Krogan [7] (ORF8-Strep (Addgene #: 141390), Spike-Strep ...
-
bioRxiv - Neuroscience 2023Quote: ... Approximately 0.2uL of pAAV5-hSyn-hM4D(Gi)-mCherry (≥ 7 x 1012vg/mL, Addgene # 50475), pAAV5-hSyn-mCherry (≥ 7 x 1012vg/mL ...
-
bioRxiv - Cell Biology 2023Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid 54920 ...
-
bioRxiv - Bioengineering 2023Quote: ... An existing plasmid was used for the expression of all 7 chaperones (Addgene #197589). For generating the DRUM or DRUMmut stable cell lines ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAV-hSyn-DIO-mCherry (400 nl at titer 7×1012, Addgene, #50459-AAV5) as control ...
-
Linear ubiquitination at damaged lysosomes induces local NF-κB activation and controls cell survivalbioRxiv - Cell Biology 2023Quote: ... GFP as non-human target (NHT) control (5’-GGAGCGCACCATCTTCTTCA-3’, 5’-GCCACAAGTTCAGCGTGTC-3’, and 5’-GGGCGAGGAGCTGTTCACCG-3’) cloned into pLentiCRISPRv2 (Addgene, 52961, deposited by Feng Zhang). To generate lentiviral particles ...
-
bioRxiv - Neuroscience 2022Quote: ... A pcDNA3 flag HA 14-3-3 β plasmid was a gift from William Sellers (Addgene plasmid # 8999 ...
-
bioRxiv - Cell Biology 2023Quote: ... and let-858 3’ UTR and mKate::HA::let-858 3’UTR from pDD287 (Addgene #70685). Correct sequences of constructed plasmids were confirmed with Sanger sequencing ...
-
bioRxiv - Cell Biology 2019Quote: ... HA-14-3-3σ (11946, Addgene) was transfected into skin keratinocytes in primary culture using the P1 Primary Cell 4D-Nucleofector™ X Kit (V4XP-1024 ...
-
bioRxiv - Bioengineering 2022Quote: ... 3 μg pMD2.G (Addgene #12259), 12 μg pCMV delta R8.2 (Addgene #12263) ...
-
bioRxiv - Cell Biology 2021Quote: ... mEmerald-ER-3 (Addgene plasmid #54082), and calnexin-mEmerlad (Addgene plasmid #54021 ...
-
bioRxiv - Cell Biology 2021Quote: ... and 3 μg pMD2.G (Addgene) were transfected into 293T cells at 80% confluency in a 10-cm dish with 8 ml of media ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 μg psPax vector (Addgene #12260), 1.5 μg pMD2.G vector (Addgene #12259 ...
-
bioRxiv - Cell Biology 2021Quote: ... or Galectin-3-GFP (Addgene; [48]). The bacterial expression vector pZsGreen (Takara Bio USA ...
-
bioRxiv - Cell Biology 2021Quote: ... pCFJ104 (Pmyo-3::mCherry, Addgene #19328) and pGH8 (Prab-3::mCherry ...
-
bioRxiv - Bioengineering 2021Quote: ... 3 µg pMD2.G (Addgene #12259) and 9 µg lentiviral vector were diluted in 1.2 mL OptiMEM ...
-
bioRxiv - Developmental Biology 2021Quote: ... U6-1 and U6-3 (Addgene plasmid #83954 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 3 μg psPAX2 (Addgene #12260) using Lipofectamine 3000 (Life Technologies ...
-
bioRxiv - Cell Biology 2024Quote: ... and 3 μg psPAX2 (AddGene 12260) using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Biochemistry 2023Quote: ... mCherry-ER-3 (Addgene, Watertown, MA), or Perilipin1-YFP[41] following established protocols[32] ...