Labshake search
Citations for Addgene :
151 - 200 of 2496 citations for 5 Nitro 1H benzo de isoquinoline 1 3 2H dione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... compact BFP-tagged CRISPRi sublibraries containing 5 sgRNAs per TSS (Addgene, Cat#83971-3 and #83975) expressed in the pCRISPRi-v2 expression vector (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: USP14_Reverse: 5’ AAACCCAATGGTATTCAAGGCTCACC 3’ were cloned into pSpCas9(BB)-2A-Puro vector (PX459, 62988, Addgene, USA) using FastDigest BpiI (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2024Quote: ... Lentiviral particles containing the sgRNA against mouse Rap1 (target: 5’-GCAGTCTAGGATGTACTGCG-3’) in lentiCRISPR v2 (Addgene plasmid # 52961 ...
-
bioRxiv - Cell Biology 2024Quote: Full-length human CEP152 with gRNA resistance (5’-CAGAACAGTTAGAAATGAGT-3’) in pAID 1.1C-T2A-Bsr (Addgene) and CEP152D43/44A in pEGFP-C1 were synthesized by GenScript ...
-
bioRxiv - Cell Biology 2024Quote: ... reverse primer: 5’-ATTTAAACTTGCTATGCTGTTTCCAGCATAGCTCTTAAAC-3’) and cloned into pLentiCRISPRv2-Opti (a gift from David Sabatini; Addgene plasmid # 163126 ...
-
bioRxiv - Cell Biology 2020Quote: ... pcDNA3-HA-human OCRL (76) was supplied by Pietro De Camilli (Addgene plasmid #22207). GFP-C1-PLCdelta-PH (53 ...
-
bioRxiv - Cell Biology 2021Quote: ... GFP-PIPK1 gamma 90 was a gift from Pietro De Camilli (Addgene plasmid # 22299) and subcloned with mScarlet-I into mammalian expression plasmids ...
-
bioRxiv - Cell Biology 2020Quote: ... TfR-pHuji was obtained from David Perrais (Université de Bordeaux, France, Addgene Plasmid #61505). Antibodies included rabbit polyclonal against TRIM67 (Boyer et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... synthesized de novo and cloned into the 20XUAS-IVS-Jaws-mVenus_tr plasmid (Addgene #111553) by swapping the Jaws-mVenus gene.
-
bioRxiv - Immunology 2022Quote: ... de Caestecker (VUMC)) and recombining it into the pENTR Gateway donor vector (Addgene, USA) using an In-Fusion ligase-independent cloning kit (Takara-Clontech) ...
-
bioRxiv - Molecular Biology 2023Quote: ... After an incubation of 1h at room temperature with a pA-Tn5 adapter complex (Addgene #124601), the Tn5 enzyme tagmentation reaction was performed by adding a buffer containing MgCl2 to the samples and incubating for 1h at 37°C ...
-
bioRxiv - Biochemistry 2020Quote: An sgRNA sequence targeting NRF2 (5’-TATTTGACTTCAGTCAGCGA-3’) was cloned into the lentiCRISPR v2 vector (Addgene #52961). Lentiviral packaging was performed by co-transfecting the resulting plasmid with psPAX2 (Addgene 12260 ...
-
bioRxiv - Cancer Biology 2021Quote: ... #2: 5’-caccgTGAAACGGATTCTTCTTTCG-3’) and cloned into the Cas9 plasmids pSpCas9(BB)−2A-Puro (PX459, Addgene #62988) and pSpCas9(BB)-2A-GFP (PX458 ...
-
bioRxiv - Immunology 2023Quote: ... Gatad2b (5’-CGTCTAGCACTCATATCCAC-3’) were cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 (53) (Addgene plasmid #62988). SgRNAs for CRISPR silencing (sgRipk3 enhP #1 ...
-
bioRxiv - Microbiology 2023Quote: ... reverse primer: 5’ – GAGTCGggatccACTAGTAGTTCCTGCTATGTCACTTCCCCTTGG – 3’) and ligating the domain into the pUC19 cloning vector (Addgene plasmid # 50005), using the T4 ligase ligation kit (New England Biolabs ...
-
bioRxiv - Bioengineering 2024Quote: ... pGEM4Z-T7-5’UTR-EGFP-3’UTR-A64 was a gift from Christopher Grigsby & Molly Stevens (Addgene plasmid # 203348 http://n2t.net/addgene:203348 ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 μg pCAS9-mCherry-Frame+1 (Addgene #66940), and 5 μg of pCRISPR-HOT_mNEON plasmid (a kind gift from Hans Clevers ...
-
bioRxiv - Biochemistry 2024Quote: ... A plasmid pCS2 HRS-RFP was a gift from Edward de Robertis (Addgene plasmid # 29685). pCoofy17 and HRS gene were linearized with PCR and subsequently assembled with sequence and ligase independent cloning approach as described in (Scholz et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... using program A-30 with 1.6 µg each of GFP and tdTomato circularised targeting vectors and 5 µg single gRNA vector PX459 (5’-TATACCTAATCATTATGCCG-3’) (Addgene, 48139, a gift from Feng Zhang). Homology arms flanking the target site were amplified from genomic DNA and cloned into pBluescript II SK(+ ...
-
bioRxiv - Cell Biology 2022Quote: ... GGAACAAGTTCAGTGAACTG, #3: TGCATGCTCACTGATAATGA), IFIH1 (#1: CTTGGACATAACAGCAACAT, #2: TGAGTTCCAAAATCTGACAT) or TLR3 (#1: ACGACTGATGCTCCGAAGGG, #2: ACTTACCTTCTGCTTGACAA, #3: GGAAATAAATGGGACCACCA) and control gRNAs (Addgene plasmid #51763, #51762 and #51760) were ligated into pLentiCRISPRv2 (Addgene plasmid # 52961 ...
-
bioRxiv - Cell Biology 2021Quote: ... The resulting scFv fragments were further amplified using the 5’ and 3’ primers (scFv primer_s and scFv primer_as) and cloned into the psfGFP-N1 vector (Addgene #54737 ...
-
bioRxiv - Systems Biology 2022Quote: A Myd88-targeting guide RNA (5’-TCGCGCTTAACGTGGGAGTG-3’) was cloned into the pX330 plasmid backbone (Addgene Plasmid #42230) and transfected using electroporation (Lonza ...
-
bioRxiv - Microbiology 2022Quote: ... The target sequence for the ACE2 gene (5′-TGCTGCTCAGTCCACCATTG-3′) was designed using CRISPR direct (https://crispr.dbcls.jp) and cloned into plentiCRISPR plasmids (21) (Addgene plasmid #52961 ...
-
bioRxiv - Molecular Biology 2022Quote: ... a sgRNA sequence cutting near MLL4 Y5477 (5’-ACGATGGTCATCGAGTACAT-3’) was cloned into lentiCRISPR v2 plasmid (Addgene #52961). The Tyrosine to Alanine point mutation was introduced using single-strand Ultramer DNA Oligonucleotide (IDT) ...
-
bioRxiv - Neuroscience 2022Quote: ... 100-200 nl virus solution of 3-5 × 1010 genome copies containing AAV5.gfaABC1d.Lck-GCaMP6f (Addgene, MA, USA) were injected at two or three sites in the craniotomy site at the cerebellar cortex (Vermis Lobule 4/5 ...
-
bioRxiv - Cancer Biology 2022Quote: ... sgRNA#2: 5’-aacctgagtgatatgactag-3’) were cloned into a modified version of the lentiCRISPR v2 backbone (RRID: Addgene_52961) in which a puromycin resistance ORF was cloned under the hPGK promoter ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 × 106 293T cells were seeded in a 10-cm plate 1 d prior to transfection and co-tranfected with the 3rd generation lentiviral packaging plasmids (5 µg pVSV.G, 3 µg pMDLg/pRRE, and 2.5 µg pRSV-Rev; Addgene # 14888 ...
-
bioRxiv - Microbiology 2024Quote: ... The 5’ p230p and 3’ p230p targeting sequences were cloned into the pPbU6-hdhfr/yfcu plasmid (Addgene #216422),44 carrying the dual positive and negative selection marker hdhfr-yfcu (human dihydrofolate reductase/yeast cytosine deaminase and uridyl phosphoribosyl transferase ...
-
bioRxiv - Cell Biology 2024Quote: CRISPR donor plasmids were cloned with 0.8 kb 5’ and 3’ homology arms amplified from fly genomic DNA into pUC57(Addgene plasmid #51019, RRID:Addgene_51019), flanking the different CTail Shot-eGFP coding sequences ...
-
bioRxiv - Neuroscience 2022Quote: ... a 3:1 mixture of AAV-CAG-Flex-oG (Addgene #74292) and ΔG-Rab-GFP was injected into either the GS or TA muscles of P1-P2 pups ...
-
bioRxiv - Biochemistry 2024Quote: ... or (1/8)NORAD-4xenv8- FL-3’antiPNA (Addgene plasmid #199209). For all experiments ...
-
bioRxiv - Neuroscience 2020Quote: ... 1:5 dilution in saline solution) or AAV1.CAG.DIO.tdTomato (control, 120 nl, 2.6×1013 vg/mL Addgene, diluted 1:5 in saline) was injected into AL ...
-
bioRxiv - Molecular Biology 2023Quote: ... a gift from Raffaele De Francesco (Addgene plasmid # 155296; http://n2t.net/addgene:155296; RRID: Addgene 155296) (38) ...
-
bioRxiv - Genomics 2022Quote: ... Protein A-MNase was expressed and purified from BL21(DE) carrying pET-pA-MN (Addgene: 86973).68–70
-
bioRxiv - Neuroscience 2021Quote: ... and sg-KCTD16-2 (5’-TTCCGCAAACCAAAATCCGG-3’) were then cloned into the AAV-U6-sgRNA-hSyn- mCherry plasmid (RRID:Addgene_87916) using the SapI site 5’ of the gRNA scaffold ...
-
bioRxiv - Biochemistry 2020Quote: An sgRNA targeting CDK12 (5’-GTGGACAAGTTTGACATTAT-3’) was cloned into the pSpCas9(BB)-2A-eGFP (PX458) vector (Addgene 48138). For CDK12 G731E/R knock-in ...
-
bioRxiv - Neuroscience 2020Quote: ... The βIII-spectrin target sequence (5’-GAGACCTGTACAGCGACCTG-3’) was inserted into pSpCas9(BB)-2A-GFP (PX458) (Addgene plasmid #48138) (Ran et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... gRNA_P2_2R: 5’-GCAGTCAAATGAACAGACGC-3’) into pX330-U6-Chimeric_BB-CBh-SpCas9 vector which digested with BbsI from Feng Zhang (Addgene plasmid # 42230 ...
-
bioRxiv - Cell Biology 2023Quote: ... JR20s were used to express Cas9 and sgRNA (5’-TCGACAGCCTTATGGCGGAC-3’) targeting mouse PFN1 25 from pLentiCRISPRv2 (Addgene #52961) by lentiviral transduction ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-AAACGGGATGCAGGGATGTCGACTc-3’) and cloning this into the unique BbsI sites of pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene # 42230), modified by the addition of a PGK-Puro cassette.
-
bioRxiv - Plant Biology 2024Quote: ... and rbcS-E9 enhancers and their 169-bp 3′ and 5′ segments as well as the 35S enhancer were PCR amplified from pZS*11_4enh (Addgene no ...
-
bioRxiv - Molecular Biology 2023Quote: ... YFP NLS Beta-Actin S14C and YFP NLS Beta-Actin G13R were a gift from Primal de Lanerolle (Addgene plasmid # 60613; http://n2t.net/addgene:60613; RRID:Addgene_60613; Addgene plasmid # 60614 ...
-
bioRxiv - Cell Biology 2023Quote: ... was a gift from Guillermo de Cárcer & Marcos Malumbres (Addgene plasmid # 136333; http://n2t.net/addgene:136333; RRID:Addgene_136333), actc1b-mKate2-EEA1 was a gift from Rob Parton (Addgene plasmid # 109508 ...
-
bioRxiv - Cell Biology 2024Quote: ... a gift from the De Camilli lab at Yale University) into the miRFP670-N1 vector (Addgene 79987) using SalI and ApaI.
-
bioRxiv - Neuroscience 2024Quote: ... and 1:5 AAV1-Ef1a-fDIO-tdTomato (128434-AAV1, Addgene, 1×10¹³ vg/mL) was made into the craniotomy ...
-
bioRxiv - Molecular Biology 2022Quote: ... Single and double RNAi constructs targeting endogenous trap-1 and trap-3 were cloned by inserting the spliced coding sequences of trap-1 and trap-3 into vector L4440 (Addgene plasmid #1654). The constructs were then transformed into the RNAi feeding E ...
-
bioRxiv - Cell Biology 2020Quote: ... designed by Life technologies to target the second exon of murine Vangl2 (gRNA: 5’-TCGGCTATTCCTACAAGTC-3’) into pSpCas9(BB)-2A-GFP (PX458, Addgene #48138). Upon transfection ...
-
bioRxiv - Molecular Biology 2020Quote: The gRNA sequence: 5’-TTAAAGAGTAACTACCAACT-3’ targeting the mouse Xpo7 gene was cloned into the PX459 plasmid (Addgene #62988, (23)) ...
-
bioRxiv - Genomics 2020Quote: ... and a revers primer (5′-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-GTGTCTCAAGATCTAGTTACGCCAAGC-3′) were used to amplify 222 bp fragments from CROPseq-Guide-Puro plasmids (#86708, Addgene) which have been inserted with different gRNA sequences ...
-
bioRxiv - Molecular Biology 2021Quote: ... or Ring1b (5’-ACAAAGAGTGTCCTACCTGT -3’) were introduced into a modified version of the vector plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene #42230) that yields a BFP marker for selection (Gift by J ...