Labshake search
Citations for Addgene :
151 - 200 of 3112 citations for 5 1 3 benzothiazol 2 ylamino pentanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: Full-length human CEP152 with gRNA resistance (5’-CAGAACAGTTAGAAATGAGT-3’) in pAID 1.1C-T2A-Bsr (Addgene) and CEP152D43/44A in pEGFP-C1 were synthesized by GenScript ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV9-hSyn- GrabDA1h (n = 5 Area X hemispheres; n = 2 MST hemispheres; Addgene), AAV5-CAG- Dlight1.1 (n = 1 Area X hemisphere ...
-
bioRxiv - Neuroscience 2024Quote: ... or AAV2/5-CMV-EGFP (250 nl, Addgene 105530, 2 × 1013 GC / ml), and which has since been published7.
-
bioRxiv - Neuroscience 2024Quote: ... n=2) or AAV9.EF1a.dflox.hChR2(H134R).EYFP.WPRE.HGH (1×10^12 pp/mL, Addgene, cohort 2, n=2). Subject mice were additionally injected in vCA2 (AP −3.0 ...
-
bioRxiv - Neuroscience 2023Quote: ... 1:2 dilution) or AAV5-pCAG-FLEX-EGFP-WPRE (1.1 x 1013 gc/ml, Addgene; 1:2 dilution) was injected in VTA (from bregma ...
-
bioRxiv - Biochemistry 2020Quote: An sgRNA sequence targeting NRF2 (5’-TATTTGACTTCAGTCAGCGA-3’) was cloned into the lentiCRISPR v2 vector (Addgene #52961). Lentiviral packaging was performed by co-transfecting the resulting plasmid with psPAX2 (Addgene 12260 ...
-
bioRxiv - Immunology 2023Quote: ... Gatad2b (5’-CGTCTAGCACTCATATCCAC-3’) were cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 (53) (Addgene plasmid #62988). SgRNAs for CRISPR silencing (sgRipk3 enhP #1 ...
-
bioRxiv - Microbiology 2023Quote: ... reverse primer: 5’ – GAGTCGggatccACTAGTAGTTCCTGCTATGTCACTTCCCCTTGG – 3’) and ligating the domain into the pUC19 cloning vector (Addgene plasmid # 50005), using the T4 ligase ligation kit (New England Biolabs ...
-
bioRxiv - Bioengineering 2024Quote: ... pGEM4Z-T7-5’UTR-EGFP-3’UTR-A64 was a gift from Christopher Grigsby & Molly Stevens (Addgene plasmid # 203348 http://n2t.net/addgene:203348 ...
-
bioRxiv - Cell Biology 2024Quote: ... we expressed the GST-tagged WIPI1/2d/3/4 from a pCAG backbone encoding GST-TEV-WIPI1/2/3/4 (RRID:Addgene_223798; RRID:Addgene_223799; RRID:Addgene_223800; RRID:Addgene_223801). The protein was expressed in FreeStyleTM HEK293F cells ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 μg pCAS9-mCherry-Frame+1 (Addgene #66940), and 5 μg of pCRISPR-HOT_mNEON plasmid (a kind gift from Hans Clevers ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 P.1 (Addgene, #170450), SARS-CoV-1 (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV-2/1/CAG-Flex-EGFP (Addgene), pENN.AAV.hsyn.Cre.WPRE.hGH (AAV1 ...
-
bioRxiv - Microbiology 2024Quote: The viral 5′UTR reporter constructs were synthesized using GeneArt and cloned into pLV-SARS-CoV-2 5′UTR-Luciferase (Addgene Cat#191480)32 using NdeI and BsaBI ...
-
bioRxiv - Developmental Biology 2021Quote: ... using program A-30 with 1.6 µg each of GFP and tdTomato circularised targeting vectors and 5 µg single gRNA vector PX459 (5’-TATACCTAATCATTATGCCG-3’) (Addgene, 48139, a gift from Feng Zhang). Homology arms flanking the target site were amplified from genomic DNA and cloned into pBluescript II SK(+ ...
-
bioRxiv - Neuroscience 2022Quote: The pCMV-hEAAT2 plasmid encoding the human excitatory amino acid transporter type 2 (EAAT2) was a gift from Susan Amara (Addgene plasmid # 32814 ...
-
bioRxiv - Cell Biology 2021Quote: ... The resulting scFv fragments were further amplified using the 5’ and 3’ primers (scFv primer_s and scFv primer_as) and cloned into the psfGFP-N1 vector (Addgene #54737 ...
-
bioRxiv - Systems Biology 2022Quote: A Myd88-targeting guide RNA (5’-TCGCGCTTAACGTGGGAGTG-3’) was cloned into the pX330 plasmid backbone (Addgene Plasmid #42230) and transfected using electroporation (Lonza ...
-
bioRxiv - Microbiology 2022Quote: ... The target sequence for the ACE2 gene (5′-TGCTGCTCAGTCCACCATTG-3′) was designed using CRISPR direct (https://crispr.dbcls.jp) and cloned into plentiCRISPR plasmids (21) (Addgene plasmid #52961 ...
-
bioRxiv - Molecular Biology 2022Quote: ... a sgRNA sequence cutting near MLL4 Y5477 (5’-ACGATGGTCATCGAGTACAT-3’) was cloned into lentiCRISPR v2 plasmid (Addgene #52961). The Tyrosine to Alanine point mutation was introduced using single-strand Ultramer DNA Oligonucleotide (IDT) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 × 106 293T cells were seeded in a 10-cm plate 1 d prior to transfection and co-tranfected with the 3rd generation lentiviral packaging plasmids (5 µg pVSV.G, 3 µg pMDLg/pRRE, and 2.5 µg pRSV-Rev; Addgene # 14888 ...
-
bioRxiv - Neuroscience 2022Quote: ... 100-200 nl virus solution of 3-5 × 1010 genome copies containing AAV5.gfaABC1d.Lck-GCaMP6f (Addgene, MA, USA) were injected at two or three sites in the craniotomy site at the cerebellar cortex (Vermis Lobule 4/5 ...
-
bioRxiv - Microbiology 2024Quote: ... The 5’ p230p and 3’ p230p targeting sequences were cloned into the pPbU6-hdhfr/yfcu plasmid (Addgene #216422),44 carrying the dual positive and negative selection marker hdhfr-yfcu (human dihydrofolate reductase/yeast cytosine deaminase and uridyl phosphoribosyl transferase ...
-
bioRxiv - Cell Biology 2024Quote: CRISPR donor plasmids were cloned with 0.8 kb 5’ and 3’ homology arms amplified from fly genomic DNA into pUC57(Addgene plasmid #51019, RRID:Addgene_51019), flanking the different CTail Shot-eGFP coding sequences ...
-
bioRxiv - Developmental Biology 2021Quote: ... sgRNA guides flanking Drp1 exon 2 or Mfn2 exon 3 were cloned into the PX459 vector (Addgene)60 ...
-
bioRxiv - Molecular Biology 2023Quote: U2OS 2-6-3 D28N were generated by electroporation of pCMV_BE4max (Addgene #112093; Koblan et al., 2018) and phU6-gRNA expression cassette encoding the guide sequence AAGCGTCAGTCTGCCCTCCA (Addgene #53188 ...
-
bioRxiv - Genetics 2023Quote: ... The germline licensed Cas9 and tbb-2 3’ UTR were amplified from pCFJ150-Cas9 (dpiRNA) (Addgene ID107940) (Zhang et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... a 3:1 mixture of AAV-CAG-Flex-oG (Addgene #74292) and ΔG-Rab-GFP was injected into either the GS or TA muscles of P1-P2 pups ...
-
bioRxiv - Biochemistry 2024Quote: ... or (1/8)NORAD-4xenv8- FL-3’antiPNA (Addgene plasmid #199209). For all experiments ...
-
bioRxiv - Neuroscience 2020Quote: ... 1:5 dilution in saline solution) or AAV1.CAG.DIO.tdTomato (control, 120 nl, 2.6×1013 vg/mL Addgene, diluted 1:5 in saline) was injected into AL ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV1.hSyn.GCaMP6f.WPRE.SV40 (120 nl, 2×1013 vg/mL Penn Vector Core/Addgene; diluted 1:2 to 1:10 in saline) was injected either into V1 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV9-EF1a-DIO-hChR2-EYFP (1:2, Addgene viral prep # 20298- AAV9 ...
-
bioRxiv - Microbiology 2023Quote: ... 6 µg of 4:2:1:1 transfer:Gag-Pol (pMDLg-pRRE, Addgene):Rev (pRSV-Rev ...
-
bioRxiv - Biochemistry 2020Quote: An sgRNA targeting CDK12 (5’-GTGGACAAGTTTGACATTAT-3’) was cloned into the pSpCas9(BB)-2A-eGFP (PX458) vector (Addgene 48138). For CDK12 G731E/R knock-in ...
-
bioRxiv - Neuroscience 2020Quote: ... The βIII-spectrin target sequence (5’-GAGACCTGTACAGCGACCTG-3’) was inserted into pSpCas9(BB)-2A-GFP (PX458) (Addgene plasmid #48138) (Ran et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... gRNA_P2_2R: 5’-GCAGTCAAATGAACAGACGC-3’) into pX330-U6-Chimeric_BB-CBh-SpCas9 vector which digested with BbsI from Feng Zhang (Addgene plasmid # 42230 ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-AAACGGGATGCAGGGATGTCGACTc-3’) and cloning this into the unique BbsI sites of pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene # 42230), modified by the addition of a PGK-Puro cassette.
-
bioRxiv - Cell Biology 2023Quote: ... JR20s were used to express Cas9 and sgRNA (5’-TCGACAGCCTTATGGCGGAC-3’) targeting mouse PFN1 25 from pLentiCRISPRv2 (Addgene #52961) by lentiviral transduction ...
-
bioRxiv - Plant Biology 2024Quote: ... and rbcS-E9 enhancers and their 169-bp 3′ and 5′ segments as well as the 35S enhancer were PCR amplified from pZS*11_4enh (Addgene no ...
-
bioRxiv - Cancer Biology 2024Quote: Truncated CPSF6 containing amino acids 1-358 (CPSF6-358) from human isoform 1 was cloned into the pCW57.1 backbone (Addgene 71782). A hemagglutinin (HA ...
-
bioRxiv - Neuroscience 2021Quote: ... The visual cortex was injected with a total of 2–3 μl of virus solution (1e13 GC/ml) containing AAV9-Syn-GCaMP6s.WPRE.SV40 (Penn Vector Core or Addgene) through a beveled glass micropipette (tip size 10–20 μm diameter ...
-
bioRxiv - Bioengineering 2021Quote: HDM-SARS2-Spike-delta21 and HDM-SARS2-Spike-del21-614G encoding SARS-CoV-2 Spike with 21 amino acid C-terminal deletion for lentiviral pseudo-typing were purchased from Addgene (Watertown, MA) with serial numbers of Addgene #155130 and Addgene#158762 ...
-
bioRxiv - Neuroscience 2024Quote: ... and 1:5 AAV1-Ef1a-fDIO-tdTomato (128434-AAV1, Addgene, 1×10¹³ vg/mL) was made into the craniotomy ...
-
bioRxiv - Molecular Biology 2022Quote: ... Single and double RNAi constructs targeting endogenous trap-1 and trap-3 were cloned by inserting the spliced coding sequences of trap-1 and trap-3 into vector L4440 (Addgene plasmid #1654). The constructs were then transformed into the RNAi feeding E ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV1-hSyn-GCaMP7b (2 × 1013 vg/mL Penn Vector Core/Addgene; diluted 1:2 in saline) for imaging of pulvinar axons ...
-
bioRxiv - Biochemistry 2020Quote: ... which were cloned into pX330A-1×2 (Addgene #58766) and combined with pX330A-2-PITCh (Addgene #63670 ...
-
bioRxiv - Neuroscience 2024Quote: ... A 1:2 viral mixture of pENN.AAV.CamKII 0.4.Cre.SV40 (Addgene, diluted 1:100,000) and pAAV-hSyn-DIO-EGFP (Addgene ...
-
bioRxiv - Cell Biology 2020Quote: ... designed by Life technologies to target the second exon of murine Vangl2 (gRNA: 5’-TCGGCTATTCCTACAAGTC-3’) into pSpCas9(BB)-2A-GFP (PX458, Addgene #48138). Upon transfection ...
-
bioRxiv - Molecular Biology 2020Quote: The gRNA sequence: 5’-TTAAAGAGTAACTACCAACT-3’ targeting the mouse Xpo7 gene was cloned into the PX459 plasmid (Addgene #62988, (23)) ...
-
bioRxiv - Genomics 2020Quote: ... and a revers primer (5′-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-GTGTCTCAAGATCTAGTTACGCCAAGC-3′) were used to amplify 222 bp fragments from CROPseq-Guide-Puro plasmids (#86708, Addgene) which have been inserted with different gRNA sequences ...