Labshake search
Citations for Addgene :
151 - 200 of 783 citations for 20 Hydroxyecdysone ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2019Quote: ... we performed inverse PCR using F primer (5’-TGAGCGGCCGCTAGGTACCTTTAA-3’) and R primer (5’-GGCACCGGGCTTGCGGGTCATGCA-3’) and pKLV-U6gRNA-EF(BbsI)-PGKpuro2ABFP (Addgene, Plasmid #62348) as a template ...
-
bioRxiv - Microbiology 2020Quote: ... targeting ACE2 (5’-TGGATACATTTGGGCAAGTG −3’) and one targeting B4GALT7 (5’-TGACCTGCTCCCTCTCAACG-3’) was cloned into the lentiGuide-Puro plasmid (Addgene plasmid #52963) following published procedure (Sanjana et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... The fragment has been amplified using the primers F-5’-TGCAGGATCCCATCGATTCGGCCACCATGAAACGGACAG -3’ and R-5’-TAGAGGCTCGAGAGGCCTTGTCAGACTTTCCTCTTCTTCTTGG -3’) from the pCAG-CBE4max-SpG-P2A-EGFP plasmid (Addgene plasmid #139998)14 and from the pCAG-CBE4max-SpRY-P2A-EGFP plasmid (Addgene plasmid #139999)14.
-
bioRxiv - Genetics 2020Quote: ... oligonucleotides for gRNA synthesis (5’ TAGGAGGAAACTGTGCTCTTCA 3’ and 5’ AAACTGAAGAGCACAGTTTCCT 3’) were annealed and ligated into plasmid pDR274 (Addgene #44250, Watertown, MA). Purified plasmid DNA was digested with DraI (New England BioLabs ...
-
bioRxiv - Immunology 2023Quote: ... Next the LentiGuide-Puro plasmid [49] was used to express a single-guide RNA (CD58 sgRNA; 5’-GAGCATTACAACAGCCATCG-3’ and ICAM4 sgRNA: 5’-CCGGGAACACCTGCGTCACG-3’) LentiGuide-Puro (Addgene plasmid # 52963) was a gift from Feng Zhang ...
-
bioRxiv - Molecular Biology 2024Quote: ... The insert containing CGG repeats within the 5’UTR of FMR1 gene fused with EGFP sequence was derived from 5’UTR CGG 99x FMR1-EGFP (Addgene plasmid #63091). The insert was ligated into the vector instead of EGFP sequence ...
-
bioRxiv - Microbiology 2024Quote: The viral 5′UTR reporter constructs were synthesized using GeneArt and cloned into pLV-SARS-CoV-2 5′UTR-Luciferase (Addgene Cat#191480)32 using NdeI and BsaBI ...
-
bioRxiv - Cell Biology 2022Quote: ... tdTurboRFP-Lysosomes-20 were gifts from Michael Davidson (Addgene plasmid # 55246 and 58061). pLJM1-Tmem192-mRFP-3xHA was a gift from Roberto Zoncu Addgene plasmid # 134631 ...
-
bioRxiv - Neuroscience 2022Quote: ... Each individual 20-nucleotide gRNA sequence were inserted into pCFD3 plasmid (Addgene #49410) using the KLD enzyme mix (New England Biolabs) ...
-
bioRxiv - Biochemistry 2022Quote: ... and mEmerald-Beta-Catenin-20 (Addgene plasmid # 54017; http://n2t.net/addgene:54017; RRID:Addgene_54017) were gifts from Michael Davidson.
-
bioRxiv - Cell Biology 2022Quote: ... mEmerald-Rab5a and mEmerald-Lysosomes-20 were both gifts from Michael Davidson (RRID:Addgene_54243 and RRID:Addgene_54149 respectively).
-
bioRxiv - Molecular Biology 2021Quote: ... pENTR constructs were combined with the expression constructs: pInducer 20 (Addgene plasmids#44012). Plasmids were validated via sequencing (Eton Biosciences ...
-
bioRxiv - Cell Biology 2023Quote: ... Soluble BFP (mTagBFP2) in pcDNA3.1 was derived from mTagBFP2-Lysosome-20 (Addgene #55308). Soluble EGFP (pEGFP-C1 plasmid ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3.7 μl of 20 mg/ml stock of homemade T7 RNA polymerase (Addgene plasmid p6XHis-T7-P266L33 ...
-
bioRxiv - Bioengineering 2023Quote: ... each 20 bp target sequence was sub-cloned into pCAGmCherry-gRNA (Addgene 87110). The CRISPR/Cas9 target sequences (20 bp target and 3 bp PAM sequence (underlined) ...
-
bioRxiv - Cancer Biology 2019Quote: ... and pLenti PGK GFP Puro (w509-5) (Addgene 19070) were gifts from Eric Campeau & Paul Kaufman ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV2/5-gfaABC1D-tdTomato was purchased from AddGene (44332).
-
bioRxiv - Neuroscience 2021Quote: ... AAV 2/5 hSyn-GCaMP6f was purchased from Addgene (Cat # 100837-AAV ...
-
bioRxiv - Neuroscience 2021Quote: ... with sgRNA (5’-CTTGTGGGGTCA-TGGTTTACAGG-3’) plasmid (Addgene, 68463), Cas9 plasmid ...
-
bioRxiv - Cell Biology 2021Quote: ... with 5 µg of Cas9-GFP plasmid (Addgene, 44719), 5 µg of sgRNA and 5 µg of ssDNA donor template (Table S1 ...
-
bioRxiv - Cell Biology 2019Quote: ... using vector sequence derived from LV1-5 (Addgene #68411) and cDNAs of SURF4 and Katushka2S (a gift from Gary Luker(100)) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 5 μg of either H2B-GFP (Addgene #11680) or H2B-RFP (Addgene #26001 ...
-
bioRxiv - Systems Biology 2023Quote: ... The CRISPRi-v2 (5 sgRNA/TSS, Addgene: Cat#83969) sgRNA library was transduced into Jurkat cells at an MOI < 0.3 (BFP+ cell percentages were ∼30%) ...
-
bioRxiv - Cell Biology 2022Quote: ... and 5 µg packaging plasmid pUMVC (Addgene, Plasmid #8449). Virus particles were collected 48 h after transfection ...
-
bioRxiv - Neuroscience 2023Quote: ... Cre- dependent AAV2/5 hSyn.DIO.hM4D(Gi)-mCherry (Addgene; #44362) expressing the inhibitory hM4Di designer receptor exclusively activated by designer drugs (iDREADD ...
-
bioRxiv - Genetics 2023Quote: ... a fli1 P-5’entry clone (Addgene, Lawson Lab), an EGFP p-middle entry (Addgene ...
-
bioRxiv - Genetics 2023Quote: ... a fli1 P-5’entry clone (Addgene, Lawson Lab), an EGFP p-middle entry (Addgene ...
-
bioRxiv - Genetics 2023Quote: ... a fli1 P-5’entry clone (Addgene, Lawson Lab), an EGFP p-middle entry (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: 5×NF-κB_RE::RedF (#124530; Addgene, Watertown, MA, USA) is the reporter plasmid consisting of a red firefly luciferase driven by a minimal promoter containing five NF-κB-binding sites (NF-κB-Luc ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 μg envelope helper plasmid (pMD2.G, Addgene #12259) and 80 μl of 1mg/ml polyethylenimine (PEI ...
-
bioRxiv - Neuroscience 2023Quote: ... 2.0 μl of AAV2/5.CAG.GCaMP6s.WPRE.SV40 (titer: 1X1013; Addgene) was injected into the left trigeminal ganglion (TG ...
-
bioRxiv - Synthetic Biology 2022Quote: ... MoClo Plant Parts Kit (Addgene Kit #1000000047), GreenGate Cloning System (Addgene Kit #1000000036 ...
-
bioRxiv - Cell Biology 2022Quote: ... Orai1-GCamp6f was a plasmid deposited in Addgene by Michael Cahalan (Addgene #73564; (20)) ...
-
bioRxiv - Genomics 2023Quote: ... 20 μg of pAdDeltaF6 (a gift from James M. Wilson, Addgene plasmid # 112867, RRID:Addgene_112867), 7 μg of pAP215-M1 library plasmid ...
-
bioRxiv - Genomics 2023Quote: ... 20 μg of pAdDeltaF6 (a gift from James M. Wilson, Addgene plasmid # 112867, RRID:Addgene_112867), 7 μg of pAP215-M1 library plasmid ...
-
bioRxiv - Bioengineering 2022Quote: ... and each 20-bp target sequence was subcloned into the pX330 vector (Addgene 42230). The CRISPR/Cas9 target sequences (20-bp target and 3-bp PAM sequence ...
-
bioRxiv - Neuroscience 2024Quote: ... 1:20 of final mix) was mixed with AAV5-hSyn-DIO-mCherry-WPRE (Addgene 50459 ...
-
bioRxiv - Cancer Biology 2024Quote: ... the pCX-EGFP beta5 integrin receptor 20 was a gift from Raymond Birge (Addgene plasmid # 14996 ...
-
bioRxiv - Plant Biology 2020Quote: ... pICH47742::2x35S-5′UTR-hCas9 (STOP)-NOST (Addgene no. 49771), pICH41780 (Addgene no ...
-
bioRxiv - Neuroscience 2020Quote: ... the AAV2/5-gfaABC1D-tdTomato was purchased from AddGene (44332), and the AAV2/5-hSyn-hChR2(H134R)-mCherry was purchased from the UNC Vector Center ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5 pmol DNA plasmids (1.5 pmol psPAX2 (Addgene #12260), 1.5 pmol pMD2.G (Addgene #12259 ...
-
bioRxiv - Neuroscience 2022Quote: ... 5 μg VSV-G expressing envelope plasmid (pMD2.G, Addgene) and 4 μg plasmid of interest (e.g ...
-
bioRxiv - Neuroscience 2019Quote: ... and 5 µl of AAV1-hSyn-eGFP-WPRE-bGH (Addgene; also pre-diluted to a 1:4 ratio in filtered 1x PBS) ...
-
bioRxiv - Neuroscience 2022Quote: ... mRuby-ER-5 was a gift from Michael Davidson (Addgene plasmid #55860 ...
-
bioRxiv - Cell Biology 2023Quote: ... the hCRISPRi-V2 compact library (Addgene #83969, 5 sgRNAs/TSS) was transduced at a MOI (multiplicity of infection <1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and TGFBR2 (5’-ccttgtagacctcggcgaag-3’) cloned into LentiCRISPRv2 puro (Addgene) (20) ...
-
bioRxiv - Neuroscience 2023Quote: ... Suppl Fig 3: AAV9-CaMKIIa-hChR2-EYFP (1:5, Addgene viral prep #26969- AAV9 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and the PMD2.G (5 μg) envelope construct (Addgene # 12259) were added to the solution ...
-
bioRxiv - Genetics 2021Quote: ... TALE modules were picked from glycerol stocks of module library plates (Addgene 1000000034), incubated overnight at 37°C in L-broth containing 50 ng/μL ampicillin and DNA isolated using the QIAprep Spin Miniprep kit (Qiagen 27104 ...
-
bioRxiv - Neuroscience 2021Quote: ... For each plate were used 30μg of pAdDeltaF6 helper plasmid (Addgene plasmid # 112867), 15μg of pAAV2-8 Rep-Cap plasmid (Addgene plasmid # 112864) ...