Labshake search
Citations for Addgene :
1901 - 1950 of 2238 citations for Human Mitochondrial Genome Maintenance Exonuclease 1 MGME1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2020Quote: ... as per the manufacturer’s instructions into pLenti CMV Hygro DEST (W117-1, a gift from Dr. Eric Campeau & Dr. Paul Kaufman, Addgene #17454) to create the final vector which was sequence verified by Sanger sequencing (Australian Genome Research Facility) ...
-
bioRxiv - Cancer Biology 2020Quote: ... we designed single guide RNAs specifically targeting exon 1 of the mouse Bmal1 gene and subcloned it into the PX459 vector (Addgene) to obtain the PX459-Bmal1 plasmid ...
-
bioRxiv - Cancer Biology 2019Quote: ... was prepared by introducing four silent mutations into the sequence targeted by shNRF2 #1 in pEN_TT 3xFLAG-NRF2 (Addgene #136527). Site-directed mutagenesis was performed with the QuikChange II XL kit (Agilent).
-
bioRxiv - Cell Biology 2021Quote: ... NANOG and PRDM14 (see Table 1) were cloned into pLentiCRISPR V2 vectors with puro (SOX2, NANOG) or hygromycin B (PRDM14) resistance (Addgene plasmids #52961 and #98291 respectively ...
-
bioRxiv - Cell Biology 2021Quote: ... gonads of young adult BOX428 animals were microinjected with 30 ng/μl Pelt-2::αGFP-NB::ZIF-1 and 2.5 ng/μl Pmyo-2::GFP (#Addgene 26347) as a co-injection marker ...
-
bioRxiv - Cell Biology 2021Quote: ... and pLKO.1 puro-based plasmid harboring the designed shRNA (pCMV-VSV-G and pLKO.1 puro were a gift from Bob Weinberg, Addgene plasmid #8454 ...
-
bioRxiv - Neuroscience 2020Quote: PV-Cre and SST-Cre slices were transfected in three different configurations: 1) 2.2 μL of ChETA (pAAV9-Ef1a-DIO-ChETA-EYFP Addgene#: 26968) and 1 μL of LSL-tdTomato (Addgene# ...
-
bioRxiv - Microbiology 2021Quote: Individual sgRNAs (sgLRRC15 #1: GACATGCAGGCACTGCACTG; sgLRRC15 #2: AGTGTCAGCCCGGGACATGC; sgACE2: GTTACATATCTGTCCTCTCC) targeting the candidate genes were cloned into linearized pXPR_502 (Addgene, #96923) for CRISPR activation ...
-
bioRxiv - Molecular Biology 2020Quote: A pET28a vector with sub-cloned cDNA of Hsp53-(1-73) (72R) and the N-terminal His-tag was procured from Addgene, (plasmid #62082) ...
-
bioRxiv - Microbiology 2021Quote: ... 10 μg of pEA216-1 was then co-transfected with 5 μg of the pCMVΔR8.2 helper plasmid (Addgene Plasmid #122263) and 1 μg of pHEF-VSV-G into 70% confluent monolayers of 293T cells in a 10 cm dish using polyethylenimine (Polysciences Inc ...
-
bioRxiv - Neuroscience 2020Quote: ... to label hyaluronic acid-based ECM we designed AAV expression vector carrying link protein hyaluronan and proteoglycan link protein 1 (HAPLN1, Gene ID: 12950) fused with mScarlet subcloned from the plasmid pCytERM_mScarlet_N1 (Addgene plasmid # 85066). Clones were verified by sequencing analysis and used for the production of adeno-associated particles as described previously (Mitlöhner et al ...
-
bioRxiv - Bioengineering 2020Quote: ... 400,000 HEK cells were seeded in 6-well plates and the next day transfected with 1 μg psPAX2 (Addgene #12260), 3 μg pCMV-VSV.G (Addgene ...
-
bioRxiv - Cell Biology 2020Quote: Huwe1 stable knockdown: The same targeting sequences as for siRNA studies were cloned to pLKO.1 puro plasmid (Addgene 8453). As control ...
-
bioRxiv - Cancer Biology 2021Quote: ... Luciferase was introduced into pediatric brain tumor cell lines using lentiviral plasmids: pLenti CMV Puro LUC (w168-1) was a gift from Eric Campeau & Paul Kaufman(45) (Addgene plasmid # 17477 ...
-
bioRxiv - Cell Biology 2022Quote: ... RPE-1 TUB-mRFP cells were generated in our lab by transduction with lentiviral vectors containing tubulin m-RFP (Addgene). HEK293T cells at a 50-70% confluence were co-transfected with lentiviral packaging vectors (16.6 μg of Pax2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were transfected with a 6:1 ratio of a firefly luciferase reporter plasmid driven by a pGL3-RARE-responsive promoter (Addgene) and a Renilla luciferase reporter plasmid driven by a constitutive CMV promoter (Promega) ...
-
bioRxiv - Biochemistry 2022Quote: ... full-length FUS with an N-terminal histidine tag and maltose-binding protein fusion (pTHMT FUS 1-526, AddGene #98651), and FUS RGG3 with N-terminal histidine tag and MBP fusion (pTHMT FUS RGG3 (453-507) ...
-
bioRxiv - Cell Biology 2022Quote: ... organoid fragments were washed and resuspended in Opti-MEM supplemented with Y-27632 (10 µM) and 10µg of pSPgRNA plasmid together with the frame selector plasmid pCAS9-mCherry-Frame +1 (Addgene #66940) and the mNEON targeting plasmid (a kind gift from V ...
-
bioRxiv - Microbiology 2022Quote: Retrovirus particles for transduction and stable cell generation were produced in HNE-1 cells following JetPrime transfection of expression plasmids (pBabe neo, pBabe-HA-LMP1 neo) and packaging plasmids pMD2.G (Addgene; number 12259 ...
-
bioRxiv - Cell Biology 2022Quote: A His-tagged mouse Capping Protein (F-actin-capping protein subunit alpha-1 and F-actin-capping protein subunit beta) plasmid was obtained from Addgene as described above (Plasmid #89950) ...
-
bioRxiv - Cell Biology 2022Quote: ... talin 2 shRNA-stable cells were co-transfected with Tln1 siRNA and EGFP-talin 1 head (Addgene plasmid no. 32856) or EGFP-talin 1 L325R (the mutant version ...
-
bioRxiv - Neuroscience 2021Quote: Other viruses used in the paper: AAV2/1-hSyn-hChR2(H134R)-EYFP was a gift from Karl Deisseroth (Addgene #26973); AAV2/1-hSyn-hM3D(Gq)-mCherry was a gift from Bryan Roth (Addgene #50474) ...
-
bioRxiv - Neuroscience 2020Quote: Full-length Susd4 mouse gene was cloned into the mammalian expression vector pEGFP-N1 (Addgene, Massachusetts, USA, Cat#6085-1) to express a SUSD4-GFP fusion construct under the control of the CMV promoter (pSUSD4-GFP) ...
-
bioRxiv - Cell Biology 2021Quote: ... Exogenous cells - MDCK cells were mosaically transfected using a CMV GFP vector (pLenti CMV GFP Blast (659-1) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid #17445 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The plasmid 6His-MBP-TEV-huLbCpf1 (plasmid # 90096) (see Figure.1 and Supplementary M3 in the Supplement Data) was purchased from Addgene. After extracted from amplified strains ...
-
bioRxiv - Immunology 2020Quote: ... with lentiviral packaging vectors pCAG-eco and psPAX.2 plus empty pLKO.1 control (EV) with a puromycin selection cassette (all obtained from Addgene) or a shRNA containing pLKO.1 targeting DGAT1 (GE Dharmacon CAT# RMM4534-EG13350 - TRCN0000124791) ...
-
bioRxiv - Cancer Biology 2020Quote: Primary dMMR mouse or human organoids were generated using lentiviral transduction as described previously.25,30 Lentivirus was prepared as previously described using the pLKO.1 system (Addgene #10878) and containing the shRNA sequences in Supplementary Table 1.24 Lentivirus was concentrated 100X by ultracentrifugation ...
-
bioRxiv - Neuroscience 2020Quote: ... The loxP-NeoR-loxP cassette was inserted at the MluI site in the intron between exons 1 and 2 following PCR amplification from pL452 (Addgene) using primers 3-For and 3-Rev ...
-
bioRxiv - Plant Biology 2022Quote: ... The first step involved the cloning of the tobacco sgRNA expression vectors (pYPQ131c, pYPQ132c, and pYPQ133c (Addgene, USA; Table 1) that contained the sgRNAs as inserts ...
-
bioRxiv - Immunology 2022Quote: ... with lentiviral packaging vectors pCAG-eco and psPAX.2 plus empty pLKO.1 control (EV) with a puromycin selection cassette (all obtained from Addgene) or a shRNA containing pLKO.1 targeting Cpt1a (GE Dharmacon CAT# RMM3981-201819967 – TRCN0000110596 ...
-
bioRxiv - Cell Biology 2022Quote: ... was constructed by recombining pENTR1a emGFP-Slc37a2 iso 2 with the pLenti PGK Hygro DEST (w530-1) vector (a gift from Eric Campeau and Paul Kaufman, Addgene plasmid # 19066 ...
-
bioRxiv - Immunology 2022Quote: ... annealed oligos were diluted 1:20 in molecular grade H2O and then ligated into Esp3I-digested pLentiCRISPR V2.0 (Addgene #52961). Ligation reactions were then transformed into Top10 competent E ...
-
bioRxiv - Cancer Biology 2019Quote: ... the HFF-1 cells were lentivirally transduced with GFP-H2B nuclear marker using the PGK-H2BeGFP system as described by Addgene and selected by flow sorting for GFP positive cells.
-
bioRxiv - Cell Biology 2019Quote: ... Annealed oligos were diluted 1/40 and 1 μl of insert was ligated into 10 ng of digested vector (pU6-sgRNA EF1Alpha-puro-T2A-BFP, Addgene plasmid #60955 digested with BstXI and Blpl ...
-
bioRxiv - Cell Biology 2019Quote: ... IRES DNA and mCherry cDNA were prepared by PCR using pEYFP SUMO-1 plasmid (from Mary Dasso: Addgene plasmid #13380), pWPI plasmid (from Didier Trono ...
-
bioRxiv - Microbiology 2020Quote: ... or human ACE2 ectodomain (containing a C-terminal His tag) were made according to the E and F sections of the pLKO.1 Protocol from Addgene (http://www.addgene.org/protocols/plko/) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and plasmids were obtained from Open Biosystems or cloned using pLKO.1-TRC (a gift from Dr. David Root (Addgene # 10878; http://n2t.net/addgene:10878; RRID: Addgene 10878)) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and plasmids were obtained from Open Biosystems or cloned using pLKO.1-TRC (a gift from Dr. David Root (Addgene # 10878 ...
-
bioRxiv - Neuroscience 2021Quote: ... mDlx-Azurite was generated by replacing EGFP with Azurite from the pAAV-mDlx-GFP-Fishell-1 plasmid (Addgene number: 83900). Generation of pORANGE Btbd11 constructs were generated using the pORANGE Cloning template vector (Addgene number ...
-
bioRxiv - Molecular Biology 2020Quote: ... The four guide sequences for the Ascl1 locus (see Table 1) were taken from (Black et al., 2016) and cloned into pmU6-gRNA (Addgene: 53187 ...
-
bioRxiv - Neuroscience 2020Quote: ... CMV-PercevalHR (1×1010 TU/mL, produced at the University of North Carolina Vector Core Facility based on plasmid # 49083, Addgene, kindly provided by Dr ...
-
bioRxiv - Microbiology 2021Quote: ... and pCT-CD63-GFP (SBI, CYTO120-PA-1) plasmids were transfected in HEK293T cells with the packaging plasmids pMD2.G (Addgene; number 12259 ...
-
bioRxiv - Neuroscience 2020Quote: To express oChIEF-mCitrine in pOXR1-Cre mice, a recombinant adeno-associated virus (rAAV, serotype 1, 4.8×1013 VC/ml titer) expressing FLEXed oChIEF-mCitrine (Addgene #50973) was package by Vector Biolabs (Malvern ...
-
bioRxiv - Immunology 2021Quote: ... par-5 and his-1 cDNA were subcloned into pCE-BiFC-VN173 and pCE-BiFC-VC155 plasmids (Addgene, Cambridge, MA), which contain the heat shock promoter Phsp-16.41 ...
-
bioRxiv - Biochemistry 2021Quote: Site-directed mutagenesis was performed on KRAS 1-169 (Q61H, isoform b, a gift from Cheryl Arrowsmith, Addgene plasmid #25153) to obtain the wild-type sequence ...
-
bioRxiv - Developmental Biology 2020Quote: ... a FLAG-tag version of the codon-optimized mouse DUX was amplified by PCR (Primers in Extended Table 1) from pCW57.1-mDUX-CA (Addgene 99284) and subcloned into the pBS31 plasmid (pBS31-FLAG_mDUX) ...
-
bioRxiv - Genomics 2021Quote: ... a gift from Bob Weinberg. The cloning of the shRNAs in the pLKO.1 plasmid was performed as per the Addgene’s pLKO.1 cloning protocol ...
-
bioRxiv - Biophysics 2020Quote: ... Then 1 μl of EGFP Lifeact-7 plasmid (mEGFP-Lifeact-7 was a gift from Michael Davidson; Addgene plasmid # 54610), 100 μl Opti-MEM ([+] HEPES ...
-
bioRxiv - Cell Biology 2020Quote: ... pWC223 encoding the motor domain of Drosophila kinesin 1 fused to BCCP (noted Kin1-biotin) was a gift from Jeff Gelles (Addgene plasmid # 15960 ...
-
bioRxiv - Neuroscience 2020Quote: All constructs containing the N/Q-rich region of the neuronal-specific Aplysia CPEB (residues 1-160) were cloned by PCR using a full-length clone (Addgene) as the template ...