Labshake search
Citations for Addgene :
1851 - 1900 of 3086 citations for 7' BROMO 2' 3' DIHYDRO 1'H SPIRO CYCLOPENTANE 1 4' ISOQUINOLINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... subcloning and sequencing The pLJM1-empty (#91980) and PD-1-miSFIT-1x (#124679) vectors were purchased from Addgene. PTEN and PD-1 were subcloned into linearized pLJM1-empty vector using EcoR1 and NHE1 restriction enzymes (NEB ...
-
bioRxiv - Neuroscience 2023Quote: ... Adeno-associated virus for expressing GcaMP7f or 8f under the synapsin-1 promoter (AAV1-syn-jGCaMP7f-WPRE; Addgene 104488 ...
-
bioRxiv - Neuroscience 2023Quote: ... or an empty vector (control, AAV5-Ef1a-DIO EYFP at titer ≥ 1×10¹³ vg/mL, Addgene plasmid # 27056) were utilized ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 mM TCEP) and digested with SUMO protease overnight (expressed and purified in-house from Addgene plasmid pCDB30243). The cleaved protein was dialyzed against Buffer D (25 mM HEPES ...
-
bioRxiv - Cell Biology 2023Quote: ... were created via PCR amplification (see primer list) and assembled into a Spe-1 digested pCFJ151 (Addgene #19330) vector using isothermal assembly (Gibson et al. ...
-
bioRxiv - Cancer Biology 2023Quote: pLKO-Tet-puro-hRAF1-shRNA-1 was a gift from Ayaz Najafov (Addgene plasmid # 185371; http://n2t.net/addgene:185371; RRID:Addgene_185371), MEK1-GFP was a gift from Rony Seger (Addgene plasmid # 14746 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were plated in 6-well plate and co-transfected with SBE4-Luc plasmid (1 μg, Addgene,16495) and pDEST26-Renilla plasmid (0.1 μg ...
-
bioRxiv - Neuroscience 2023Quote: ... we additionally injected an AAV encoding for jRGECO1a (AAV2/1-Syn-NES-jRGECO1a-WPRE-SV40, Addgene 100854-AAV1) in 3 locations in V1 (roughly the vertices of a 550 μm-wide equilateral triangle centered 3.5 mm posterior and 2.6 mm lateral to Bregma ...
-
bioRxiv - Cell Biology 2023Quote: ... The pEGFP-N1- hDEK plasmid (DEK WT sequence inserted into eGFP reporter plasmid “peGFP-N1”; Addgene 6085-1) was used as a template for mutagenesis PCR ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 ng of pcDNA3.3-hCas9 plasmid (constructed by inserting the Cas9 fragment released from Addgene #41815 (ref. 119), into the pcDNA3.3 vector ...
-
bioRxiv - Immunology 2022Quote: shRNAs were designed to target human Galectin-9 mRNA and cloned into the pLKO.1 vector (Addgene #10878). The sense shRNA sequences are CCTGGTGCAGAGCTCAGATTT (shGal-9 #1 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... flanked by 1-kb Nelfe HDR sequences: The insert was obtained from pCRIS-PITCHv2-dTAG-Puro (Addgene 91796) (Nabet et al ...
-
bioRxiv - Genomics 2022Quote: ... The open reading frames of H3 and H4 were cloned in the Dox-inducible expression vector KA0717 (KA0717_pPB-hCMV*1-cHA-IRESVenus was a gift from Hans Schöler, Addgene plasmid #124168 ...
-
bioRxiv - Developmental Biology 2023Quote: ... nls::Cas9::nls (subcloned from Eef1a-1955/- 1>nls::Cas9::nls a gift from Lionel Christiaen, Addgene plasmid # 59987 ;http://n2t.net/addgene:59987 ; RRID:Addgene_59987)52 ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... coding for the large T oncogene SV40 (V40 1: pBSSVD2005 was a gift from David Ron; Addgene plasmid #21826; http://n2t.net/addgene:21826; RRID:Addgene_21826), using LipofectamineTM LTX (Invitrogen #L3000-008 ...
-
bioRxiv - Cancer Biology 2023Quote: ... (MSCV-IRES-Thy1.1 DEST was provided to Addgene by Dr. Anjana Rao, Addgene plasmid# 17442 ; http://n2t.net/addgene:17442 ; RRID:Addgene_17442) using TaKaRa In-Fusion HD Cloning Plus kits (Cat# 638917 ...
-
bioRxiv - Neuroscience 2023Quote: ... The annealed oligos were then ligated into U6 promotor-based cassettes: ipo13b sgRNA1 into pU6a:sgRNA#1 (Addgene #64245), ipo13b sgRNA2 into pU6a:sgRNA#2 (Addgene #64246) ...
-
bioRxiv - Neuroscience 2023Quote: The following expression constructs were used: human CaV2.2 (huCaV2.2 (pSAD442-1) was a gift from Diane Lipscombe (Addgene plasmid # 62574 ...
-
bioRxiv - Physiology 2023Quote: ... 1 ng of pcDNA3.3-hCas9 plasmid (constructed by inserting the Cas9 fragment released from Addgene #41815 (ref. 130), into the pcDNA3.3 vector ...
-
bioRxiv - Microbiology 2024Quote: ... N/Tert-1 Cas9 knockout cells were generated by transduction with a spCas9 lentiviral expression vector (Addgene # 52962) and selecting with blasticidin ...
-
bioRxiv - Microbiology 2023Quote: ... pcDNA3.1-HA-Ubiquitin (Ub) was a gift from Edward Yeh (Addgene plasmid #18712; http://n2t.net/addgene:18712; RRID:Addgene_18712). Full length tsa56 (OTT_0945 ...
-
bioRxiv - Cancer Biology 2023Quote: We cloned the following oligonucleotides into the pLKO.1 mCherry constitutive vector (Dr Oskar Laur’s lab, Cat#128073; RRID:Addgene_128073) ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.5 µL of a mix of pAAV-TREtight0mTag-BFP2- B19G (diluted 1:20 in dPBS; Addgene: 100799-AAV1) and pAAV-syn-FLEX-splitTVA-EGFP- tTA (diluted 1:200 in dPBS ...
-
bioRxiv - Cell Biology 2023Quote: ... pAS139 was used in a multi-site Gateway LR reaction together with entry plasmids pCG142 (pie-1 intron:pie-1 promoter in PDONRP4P1R) and pCM1.53 (GFP with worm codon bias and synthetic introns in pDONR201) (Addgene plasmids # 17246 and # 17250 ...
-
bioRxiv - Cancer Biology 2023Quote: Whole genome CRISPR Screening was performed using the Human CRISPR Knockout Pooled Library (Brunello) - 1 vector system (Addgene and a gift from John Doench to the Functional Genomics Facility at the University of Colorado Anschutz Medical Campus)(44) ...
-
bioRxiv - Cancer Biology 2024Quote: ... WT and mutant constructs were subsequently cloned into the vector pLenti CMV Neo DEST (705-1) (Addgene, #17392) by the GATEWAY cloning system ...
-
bioRxiv - Cell Biology 2024Quote: ... pCSII-EF-miRFP670v1-hGem(1/110) was a gift from Vladislav Verkhusha (Addgene plasmid # 80006; http://n2t.net/addgene:80006; RRID:Addgene_80006). Supernatants containing lentiviral pseudoparticles were harvested 24 and 48 h post-transfection ...
-
bioRxiv - Cancer Biology 2024Quote: ... The pLKO.1 shRNA plasmid targeting human TSC2 was a gift from Do-Hyung Kim (Cat#15478, Addgene). Lentiviral pLKO shRNA plasmids were transiently co-transfected individually along with plasmids encoding ΔVPR and VSV-G into HEK293T cells using TurboFect™ (Cat#R0531 ...
-
bioRxiv - Bioengineering 2024Quote: The Talin 1 rod domain R1-R2 (mouse talin1 482-786) was flanked between SNAP-tag (Addgene #101135) and HaloTag (Promega G8031) ...
-
bioRxiv - Neuroscience 2024Quote: ... The generated myo-3p::circ-crh-1 construct along with the unc-122p::RFP co-injection marker (AddGene) were injected into VDL1300 crh-1(syb385) ...
-
bioRxiv - Immunology 2024Quote: E2F-1 wt-pGex2TK was a gift from William Kaelin (Addgene plasmid # 21668 ; http://n2t.net/addgene:21668 ; RRID:Addgene_21668). The construct was cloned into N- terminal maltose-binding protein (MBP ...
-
bioRxiv - Cell Biology 2024Quote: ... and safe-targets (sgSAFE #5784) (see Table 1) were selected from the Bassik Human CRISPR Knockout Library (Addgene, 101926 ...
-
bioRxiv - Bioengineering 2020Quote: ... and pcDNA3-SARS-CoV-2-S-RBD-Fc (Addgene Plasmid #141183) were obtained as gifts from Erik Procko ...
-
bioRxiv - Molecular Biology 2021Quote: ... (2) LwaCas13a coding sequence and Shine-Dalgarno sequence amplified from Addgene #91865 using primers oAM1496 and oAM1497 ...
-
bioRxiv - Molecular Biology 2021Quote: SARS-CoV-2 viral proteins were amplified via PCR from Addgene constructs with a 1x (GGGS ...
-
bioRxiv - Synthetic Biology 2019Quote: ... and 2 μg of I-SceI expression plasmid pCBASceI (Addgene #26477) using lipofectamine® 3000 (#11668019 ...
-
bioRxiv - Biochemistry 2019Quote: EGFP-hArgonaute-2 (eGFP-Ago2) was purchased from (Addgene plasmid # 21981) and was prepared in the laboratory of Philip Sharp (MIT) ...
-
bioRxiv - Genomics 2019Quote: ... The packaging vectors PmD2G and PsPAX.2 were obtained from Addgene. Exponentially growing 293T cells were split and seeded at 8 x 106 cells in 100 mm dishes in RPMI 1640 medium at 37C ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 spike or VSV-G (pMD2.G (Addgene #12259)) using VigoFect (Vigorous Biotechnology) ...
-
bioRxiv - Biochemistry 2021Quote: ... and SARS-CoV-2 nsp14/nsp10-His-3xFlag (Addgene ID 169164) were expressed in baculovirus-infected Sf9 insect cells ...
-
bioRxiv - Biochemistry 2021Quote: ... we co-transformed plasmids SARS-CoV-2 nsp10 (Addgene ID 169158) and SARS-CoV-2 3xFlag-nsp5CS-nsp14 (Addgene ID 169159) ...
-
bioRxiv - Biophysics 2021Quote: ... the pet28 plasmid containing His6 SARS-CoV-2 nsp13 (Addgene #159390) was transformed into E ...
-
bioRxiv - Neuroscience 2020Quote: Brainbow3.0 AAV-2/9 and AAV-PhP.EB were obtained from Addgene and University of Michigan vector core ...
-
bioRxiv - Systems Biology 2021Quote: ... and pX458-sgRNA_miR290-295_1/2 for KO2 (Addgene #172709 and #172710). After 48 hours ...
-
bioRxiv - Physiology 2021Quote: EGFP-hArgonaute-2 (eGFP-Ago2) was purchased from (Addgene plasmid # 21981) and was prepared in the laboratory of Philip Sharp (MIT) ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV1-flex-ChR2-Tdtomato (Addgene, titer 2*1012/ml, 0.5 μl) or AAV1-flex-ChR2-mCherry (Charite Vector core ...
-
bioRxiv - Cell Biology 2021Quote: The human GeCKO v2 library (2 plasmid system) (Addgene plasmid #1000000049) was amplified by electroporation using a Bio-Rad Gene Pulser II electroporation apparatus (Bio-Rad #165-2105 ...
-
bioRxiv - Cell Biology 2020Quote: Plasmids for biosensors were purchased from Addgene (see Supplementary Table 2). ERKKTR ...
-
bioRxiv - Cell Biology 2021Quote: ... and the three injection markers pCFJ90 (Pmyo-2::mCherry, Addgene #19327), pCFJ104 (Pmyo-3::mCherry ...
-
bioRxiv - Neuroscience 2022Quote: pAAV2/2-hSyn-DIO-hM4D(Gi)-mCherry (Addgene #44362, Roth Lab) was injected intraocularly in VGluT3-Cre mice ...